rs1554430908

Variant names:

• chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C
• rs1554430908
• NM_000238.4:c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000238.4(KCNH2):​c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA​(p.Thr74ArgfsTer32) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T74T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 34)
• Consequence: KCNH2 NM_000238.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.04
• Publications: 0 publications found

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

KCNH2 Gene-Disease associations (from GenCC):

• long QT syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• long QT syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• short QT syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• short QT syndrome type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Brugada syndrome

  Inheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C is Pathogenic according to our data. Variant chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 503735.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000238.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNH2	NM_000238.4	MANE Select	c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr74ArgfsTer32	frameshift	Exon 2 of 15	NP_000229.1	A0A090N8Q0
	KCNH2	NM_172056.3		c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr74ArgfsTer32	frameshift	Exon 2 of 9	NP_742053.1	Q12809-5
	KCNH2	NM_001406755.1		c.44_74delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr15ArgfsTer32	frameshift	Exon 2 of 9	NP_001393684.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNH2	ENST00000262186.10	TSL:1 MANE Select	c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr74ArgfsTer32	frameshift	Exon 2 of 15	ENSP00000262186.5	Q12809-1
	KCNH2	ENST00000713710.1		c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr74ArgfsTer32	frameshift	Exon 2 of 15	ENSP00000519013.1	A0AAQ5BGR0
	KCNH2	ENST00000945647.1		c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr74ArgfsTer32	frameshift	Exon 2 of 14	ENSP00000615706.1

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Long QT syndrome (2)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.0
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554430908; hg19: chr7-150671854;