rs1554430908

Positions:

• chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000238.4(KCNH2):​c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA​(p.Thr74fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 34)
• Consequence: KCNH2 NM_000238.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.04

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

KCNH2 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C is Pathogenic according to our data. Variant chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C is described in ClinVar as [Pathogenic]. Clinvar id is 503735.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr7-150974766-CTGCGCGATCTGCGCGGCAGCGCGGCGCTGCG-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KCNH2	NM_000238.4	c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr74fs	frameshift_variant	2/15	ENST00000262186.10	NP_000229.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KCNH2	ENST00000262186.10	c.221_251delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA	p.Thr74fs	frameshift_variant	2/15	1	NM_000238.4	ENSP00000262186.5
KCNH2	ENST00000532957.5	n.444_474delCGCAGCGCCGCGCTGCCGCGCAGATCGCGCA		non_coding_transcript_exon_variant	2/9	2

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Long QT syndrome Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Feb 20, 2024	Variant summary: KCNH2 c.221_251del31 (p.Thr74ArgfsX32) results in a premature termination codon, predicted to cause absence of the protein due to nonsense mediated decay, which is a commonly known mechanism for disease. The variant was absent in 228884 control chromosomes (gnomAD). c.221_251del31 has been reported in the literature in individuals affected with Long QT Syndrome (e.g. Shimizu_2009). These data indicate that the variant is likely associated with disease. The following publication has been ascertained in the context of this evaluation (PMID: 19926013). ClinVar contains an entry for this variant (Variation ID: 503735). Based on the evidence outlined above, the variant was classified as pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Dec 13, 2023	This sequence change creates a premature translational stop signal (p.Thr74Argfs*32) in the KCNH2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in KCNH2 are known to be pathogenic (PMID: 10973849, 19862833). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with KCNH2-related conditions. ClinVar contains an entry for this variant (Variation ID: 503735). For these reasons, this variant has been classified as Pathogenic. -

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Oct 02, 2019

Reported in ClinVar as a pathogenic variant by another clinical laboratory (ClinVar Variant ID# 503735; Landrum et al., 2016); Not observed in large population cohorts (Lek et al., 2016); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 10973849, 15840476, 19038855) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554430908; hg19: chr7-150671854;