chr7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C

Variant names:

• chr7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C
• rs1554493810
• NM_000193.4:c.851_873delAGCCCGAGGCGTCCTCGGGCTCG

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000193.4(SHH):​c.851_873delAGCCCGAGGCGTCCTCGGGCTCG​(p.Glu284GlyfsTer31) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SHH NM_000193.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.69

Genes affected

SHH (HGNC:10848): (sonic hedgehog signaling molecule) This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 22 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C is Pathogenic according to our data. Variant chr7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C is described in ClinVar as [Pathogenic]. Clinvar id is 464839.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SHH	NM_000193.4	c.851_873delAGCCCGAGGCGTCCTCGGGCTCG	p.Glu284GlyfsTer31	frameshift_variant	Exon 3 of 3	ENST00000297261.7	NP_000184.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SHH	ENST00000297261.7	c.851_873delAGCCCGAGGCGTCCTCGGGCTCG	p.Glu284GlyfsTer31	frameshift_variant	Exon 3 of 3	1	NM_000193.4	ENSP00000297261.2
SHH	ENST00000430104.5	c.301+2858_301+2880delAGCCCGAGGCGTCCTCGGGCTCG		intron_variant	Intron 3 of 3	1		ENSP00000396621.1
SHH	ENST00000435425.1	n.302-2841_302-2819delAGCCCGAGGCGTCCTCGGGCTCG		intron_variant	Intron 3 of 4	1		ENSP00000413871.1
SHH	ENST00000441114.5	n.302-2771_302-2749delAGCCCGAGGCGTCCTCGGGCTCG		intron_variant	Intron 3 of 4	1		ENSP00000410546.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Holoprosencephaly 3 Pathogenic:1

May 30, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change deletes 23 nucleotide in exon 3 of the SHH mRNA (c.851_873del), causing a frameshift at codon 284. This creates a premature translational stop signal in the last exon of the SHH mRNA (p.Glu284Glyfs*31). While this is not anticipated to result in nonsense mediated decay, it is expected to result in a truncated SHH protein that disrupts the final 178 amino acids. For these reasons, this variant has been classified as Pathogenic. Approximately 30% of SHH-related holoprosencephaly cases have been observed to be de novo (PMID: 21940735).   In addition, clinical and experimental evidence strongly suggest that the C-terminus of the SHH protein is critical for functional activity (PMID: 9335337, 15292211, 15292211, 22791840, 19603532, 25569381). This variant has been observed to be de novo in an individual affected with microcephaly, hypotelorism and maxillary central teeth fusion (Invitae). While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554493810; hg19: chr7-155596109;