rs1554493810

Variant names:

• chr7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C
• rs1554493810
• NM_000193.4:c.851_873delAGCCCGAGGCGTCCTCGGGCTCG

Variant summary

Our verdict is Pathogenic. The variant received 14 ACMG points: 14P and 0B. PVS1 PS3 PP5_Moderate

The NM_000193.4(SHH):​c.851_873delAGCCCGAGGCGTCCTCGGGCTCG​(p.Glu284GlyfsTer31) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). ClinVar reports functional evidence for this variant: "SCV000639508: In addition, clinical and experimental evidence strongly suggest that the C-terminus of the SHH protein is critical for functional activity (PMID:¬†9335337, 15292211, 15292211,¬†22791840,¬†19603532, 25569381).".

• Frequency: Genomes: not found (cov: 32)
• Consequence: SHH NM_000193.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.69
• Publications: 0 publications found

Genes affected

SHH (HGNC:10848): (sonic hedgehog signaling molecule) This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]

SHH Gene-Disease associations (from GenCC):

• holoprosencephaly 3

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, PanelApp Australia, Labcorp Genetics (formerly Invitae)
• microphthalmia, isolated, with coloboma 5

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• polydactyly of a triphalangeal thumb

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• solitary median maxillary central incisor syndrome

  Inheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
• skeletal system disorder

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• autosomal dominant preaxial polydactyly-upperback hypertrichosis syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hypoplastic tibiae-postaxial polydactyly syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• microphthalmia, isolated, with coloboma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• syndactyly type 4

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• triphalangeal thumb-polysyndactyly syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• holoprosencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 42 pathogenic variants in the truncated region.
• PS3: PS3 evidence extracted from ClinVar submissions: SCV000639508: In addition, clinical and experimental evidence strongly suggest that the C-terminus of the SHH protein is critical for functional activity (PMID:¬†9335337, 15292211, 15292211,¬†22791840,¬†19603532, 25569381).
• PP5: Variant 7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C is Pathogenic according to our data. Variant chr7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 464839.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000193.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SHH	NM_000193.4	MANE Select	c.851_873delAGCCCGAGGCGTCCTCGGGCTCG	p.Glu284GlyfsTer31	frameshift	Exon 3 of 3	NP_000184.1	Q15465
	SHH	NM_001310462.2		c.301+2858_301+2880delAGCCCGAGGCGTCCTCGGGCTCG		intron	N/A	NP_001297391.1
	SHH	NR_132318.2		n.563-2771_563-2749delAGCCCGAGGCGTCCTCGGGCTCG		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SHH	ENST00000297261.7	TSL:1 MANE Select	c.851_873delAGCCCGAGGCGTCCTCGGGCTCG	p.Glu284GlyfsTer31	frameshift	Exon 3 of 3	ENSP00000297261.2	Q15465
	SHH	ENST00000430104.5	TSL:1	c.301+2858_301+2880delAGCCCGAGGCGTCCTCGGGCTCG		intron	N/A	ENSP00000396621.1	C9JC48
	SHH	ENST00000435425.1	TSL:1	n.302-2841_302-2819delAGCCCGAGGCGTCCTCGGGCTCG		intron	N/A	ENSP00000413871.1	F8WEH4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Holoprosencephaly 3 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.7
Mutation Taster		=11/189	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554493810; hg19: chr7-155596109;