rs1554493810

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000193.4(SHH):​c.851_873delAGCCCGAGGCGTCCTCGGGCTCG​(p.Glu284fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

SHH
NM_000193.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 2.69
Variant links:
Genes affected
SHH (HGNC:10848): (sonic hedgehog signaling molecule) This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 22 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C is Pathogenic according to our data. Variant chr7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C is described in ClinVar as [Pathogenic]. Clinvar id is 464839.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
SHHNM_000193.4 linkuse as main transcriptc.851_873delAGCCCGAGGCGTCCTCGGGCTCG p.Glu284fs frameshift_variant 3/3 ENST00000297261.7 NP_000184.1 Q15465

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
SHHENST00000297261.7 linkuse as main transcriptc.851_873delAGCCCGAGGCGTCCTCGGGCTCG p.Glu284fs frameshift_variant 3/31 NM_000193.4 ENSP00000297261.2 Q15465
SHHENST00000430104.5 linkuse as main transcriptc.301+2858_301+2880delAGCCCGAGGCGTCCTCGGGCTCG intron_variant 1 ENSP00000396621.1 C9JC48
SHHENST00000435425.1 linkuse as main transcriptn.302-2841_302-2819delAGCCCGAGGCGTCCTCGGGCTCG intron_variant 1 ENSP00000413871.1 F8WEH4
SHHENST00000441114.5 linkuse as main transcriptn.302-2771_302-2749delAGCCCGAGGCGTCCTCGGGCTCG intron_variant 1 ENSP00000410546.1 F8WB84

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Holoprosencephaly 3 Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpMay 30, 2018For these reasons, this variant has been classified as Pathogenic. Approximately 30% of SHH-related holoprosencephaly cases have been observed to be de novo (PMID: 21940735).   In addition, clinical and experimental evidence strongly suggest that the C-terminus of the SHH protein is critical for functional activity (PMID: 9335337, 15292211, 15292211, 22791840, 19603532, 25569381). This variant has been observed to be de novo in an individual affected with microcephaly, hypotelorism and maxillary central teeth fusion (Invitae). While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This sequence change deletes 23 nucleotide in exon 3 of the SHH mRNA (c.851_873del), causing a frameshift at codon 284. This creates a premature translational stop signal in the last exon of the SHH mRNA (p.Glu284Glyfs*31). While this is not anticipated to result in nonsense mediated decay, it is expected to result in a truncated SHH protein that disrupts the final 178 amino acids. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554493810; hg19: chr7-155596109; API