rs1554493810
Variant summary
Our verdict is Pathogenic. The variant received 14 ACMG points: 14P and 0B. PVS1PS3PP5_Moderate
The NM_000193.4(SHH):c.851_873delAGCCCGAGGCGTCCTCGGGCTCG(p.Glu284GlyfsTer31) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). ClinVar reports functional evidence for this variant: "SCV000639508: In addition, clinical and experimental evidence strongly suggest that the C-terminus of the SHH protein is critical for functional activity (PMID:¬†9335337, 15292211, 15292211,¬†22791840,¬†19603532, 25569381).".
Frequency
Consequence
NM_000193.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- holoprosencephaly 3Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), PanelApp Australia, G2P
- microphthalmia, isolated, with coloboma 5Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
- polydactyly of a triphalangeal thumbInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- solitary median maxillary central incisor syndromeInheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: G2P, Ambry Genetics
- skeletal system disorderInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- autosomal dominant preaxial polydactyly-upperback hypertrichosis syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hypoplastic tibiae-postaxial polydactyly syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- microphthalmia, isolated, with colobomaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- syndactyly type 4Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- triphalangeal thumb-polysyndactyly syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- holoprosencephalyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 14 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000193.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SHH | MANE Select | c.851_873delAGCCCGAGGCGTCCTCGGGCTCG | p.Glu284GlyfsTer31 | frameshift | Exon 3 of 3 | NP_000184.1 | Q15465 | ||
| SHH | c.301+2858_301+2880delAGCCCGAGGCGTCCTCGGGCTCG | intron | N/A | NP_001297391.1 | |||||
| SHH | n.563-2771_563-2749delAGCCCGAGGCGTCCTCGGGCTCG | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SHH | TSL:1 MANE Select | c.851_873delAGCCCGAGGCGTCCTCGGGCTCG | p.Glu284GlyfsTer31 | frameshift | Exon 3 of 3 | ENSP00000297261.2 | Q15465 | ||
| SHH | TSL:1 | c.301+2858_301+2880delAGCCCGAGGCGTCCTCGGGCTCG | intron | N/A | ENSP00000396621.1 | C9JC48 | |||
| SHH | TSL:1 | n.302-2841_302-2819delAGCCCGAGGCGTCCTCGGGCTCG | intron | N/A | ENSP00000413871.1 | F8WEH4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.