chr7-4785616-GGCGGGTGCGCGGGGACCCGGCCTCTGT-G
Variant summary
Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3
The NM_014855.3(AP5Z1):c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC(p.Arg358_Val366del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000082 in 1,584,508 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_014855.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 5 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
AP5Z1 | NM_014855.3 | c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC | p.Arg358_Val366del | disruptive_inframe_deletion | Exon 9 of 17 | ENST00000649063.2 | NP_055670.1 | |
AP5Z1 | NM_001364858.1 | c.605_631delGCGGGGACCCGGCCTCTGTGCGGGTGC | p.Arg202_Val210del | disruptive_inframe_deletion | Exon 8 of 16 | NP_001351787.1 | ||
AP5Z1 | XM_047421098.1 | c.737_763delGCGGGGACCCGGCCTCTGTGCGGGTGC | p.Arg246_Val254del | disruptive_inframe_deletion | Exon 7 of 15 | XP_047277054.1 | ||
AP5Z1 | NR_157345.1 | n.1166_1192delGCGGGGACCCGGCCTCTGTGCGGGTGC | non_coding_transcript_exon_variant | Exon 9 of 17 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152222Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.0000101 AC: 2AN: 197432Hom.: 0 AF XY: 0.00000926 AC XY: 1AN XY: 108020
GnomAD4 exome AF: 0.00000838 AC: 12AN: 1432286Hom.: 0 AF XY: 0.0000113 AC XY: 8AN XY: 710640
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152222Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74366
ClinVar
Submissions by phenotype
not specified Uncertain:1
- -
Hereditary spastic paraplegia 48 Uncertain:1
This variant has not been reported in the literature in individuals affected with AP5Z1-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 446845). This variant is present in population databases (no rsID available, gnomAD 0.007%). This variant, c.1073_1099del, results in the deletion of 9 amino acid(s) of the AP5Z1 protein (p.Arg358_Val366del), but otherwise preserves the integrity of the reading frame. -
Hereditary spastic paraplegia Uncertain:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at