rs1339701497
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3
The NM_014855.3(AP5Z1):c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC(p.Arg358_Val366del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000082 in 1,584,508 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. R358R) has been classified as Likely benign.
Frequency
Consequence
NM_014855.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- hereditary spastic paraplegiaInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- hereditary spastic paraplegia 48Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_014855.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AP5Z1 | MANE Select | c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC | p.Arg358_Val366del | disruptive_inframe_deletion | Exon 9 of 17 | NP_055670.1 | O43299-1 | ||
| AP5Z1 | c.605_631delGCGGGGACCCGGCCTCTGTGCGGGTGC | p.Arg202_Val210del | disruptive_inframe_deletion | Exon 8 of 16 | NP_001351787.1 | ||||
| AP5Z1 | n.1166_1192delGCGGGGACCCGGCCTCTGTGCGGGTGC | non_coding_transcript_exon | Exon 9 of 17 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AP5Z1 | MANE Select | c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC | p.Arg358_Val366del | disruptive_inframe_deletion | Exon 9 of 17 | ENSP00000497815.1 | O43299-1 | ||
| AP5Z1 | c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC | p.Arg358_Val366del | disruptive_inframe_deletion | Exon 9 of 18 | ENSP00000535693.1 | ||||
| AP5Z1 | c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC | p.Arg358_Val366del | disruptive_inframe_deletion | Exon 9 of 17 | ENSP00000535695.1 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152222Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.0000101 AC: 2AN: 197432 AF XY: 0.00000926 show subpopulations
GnomAD4 exome AF: 0.00000838 AC: 12AN: 1432286Hom.: 0 AF XY: 0.0000113 AC XY: 8AN XY: 710640 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152222Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74366 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at