rs1339701497

Variant names:

• chr7-4785616-GGCGGGTGCGCGGGGACCCGGCCTCTGT-G
• rs1339701497
• NM_014855.3:c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_014855.3(AP5Z1):​c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC​(p.Arg358_Val366del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000082 in 1,584,508 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000084 (0 hom.)
• Consequence: AP5Z1 NM_014855.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 7.71

Genes affected

AP5Z1 (HGNC:22197): (adaptor related protein complex 5 subunit zeta 1) This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_014855.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AP5Z1	NM_014855.3	c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC	p.Arg358_Val366del	disruptive_inframe_deletion	Exon 9 of 17	ENST00000649063.2	NP_055670.1
AP5Z1	NM_001364858.1	c.605_631delGCGGGGACCCGGCCTCTGTGCGGGTGC	p.Arg202_Val210del	disruptive_inframe_deletion	Exon 8 of 16		NP_001351787.1
AP5Z1	XM_047421098.1	c.737_763delGCGGGGACCCGGCCTCTGTGCGGGTGC	p.Arg246_Val254del	disruptive_inframe_deletion	Exon 7 of 15		XP_047277054.1
AP5Z1	NR_157345.1	n.1166_1192delGCGGGGACCCGGCCTCTGTGCGGGTGC		non_coding_transcript_exon_variant	Exon 9 of 17

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AP5Z1	ENST00000649063.2	c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC	p.Arg358_Val366del	disruptive_inframe_deletion	Exon 9 of 17		NM_014855.3	ENSP00000497815.1

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152222 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000101 AC: 2 AN: 197432 Hom.: 0 AF XY: 0.00000926 AC XY: 1 AN XY: 108020

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000671

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000838 AC: 12 AN: 1432286 Hom.: 0 AF XY: 0.0000113 AC XY: 8 AN XY: 710640

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000487

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000241

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000636

Gnomad4 OTH exome AF: 0.0000168

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152222 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74366

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000147

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000189

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

Dec 29, 2016

Athena Diagnostics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary spastic paraplegia 48 Uncertain:1

Apr 12, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has not been reported in the literature in individuals affected with AP5Z1-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 446845). This variant is present in population databases (no rsID available, gnomAD 0.007%). This variant, c.1073_1099del, results in the deletion of 9 amino acid(s) of the AP5Z1 protein (p.Arg358_Val366del), but otherwise preserves the integrity of the reading frame. -

Hereditary spastic paraplegia Uncertain:1

Mar 03, 2020

Genome Diagnostics Laboratory, The Hospital for Sick Children

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1339701497; hg19: chr7-4825247;