rs1339701497

Variant names:

• chr7-4785616-GGCGGGTGCGCGGGGACCCGGCCTCTGT-G
• rs1339701497
• NM_014855.3:c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_014855.3(AP5Z1):​c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC​(p.Arg358_Val366del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000082 in 1,584,508 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. R358R) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000084 (0 hom.)
• Consequence: AP5Z1 NM_014855.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 7.71
• Publications: 0 publications found

Genes affected

AP5Z1 (HGNC:22197): (adaptor related protein complex 5 subunit zeta 1) This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]

AP5Z1 Gene-Disease associations (from GenCC):

• hereditary spastic paraplegia

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• hereditary spastic paraplegia 48

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_014855.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_014855.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AP5Z1	NM_014855.3	MANE Select	c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC	p.Arg358_Val366del	disruptive_inframe_deletion	Exon 9 of 17	NP_055670.1	O43299-1
	AP5Z1	NM_001364858.1		c.605_631delGCGGGGACCCGGCCTCTGTGCGGGTGC	p.Arg202_Val210del	disruptive_inframe_deletion	Exon 8 of 16	NP_001351787.1
	AP5Z1	NR_157345.1		n.1166_1192delGCGGGGACCCGGCCTCTGTGCGGGTGC		non_coding_transcript_exon	Exon 9 of 17

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AP5Z1	ENST00000649063.2	MANE Select	c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC	p.Arg358_Val366del	disruptive_inframe_deletion	Exon 9 of 17	ENSP00000497815.1	O43299-1
	AP5Z1	ENST00000865634.1		c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC	p.Arg358_Val366del	disruptive_inframe_deletion	Exon 9 of 18	ENSP00000535693.1
	AP5Z1	ENST00000865636.1		c.1073_1099delGCGGGGACCCGGCCTCTGTGCGGGTGC	p.Arg358_Val366del	disruptive_inframe_deletion	Exon 9 of 17	ENSP00000535695.1

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152222 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000101 AC: 2 AN: 197432 AF XY: 0.00000926

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000671

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000838 AC: 12 AN: 1432286 Hom.: 0 AF XY: 0.0000113 AC XY: 8 AN XY: 710640

African (AFR) AF: 0.00 AC: 0 AN: 33082

American (AMR) AF: 0.0000487 AC: 2 AN: 41048

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25632

East Asian (EAS) AF: 0.00 AC: 0 AN: 38526

South Asian (SAS) AF: 0.0000241 AC: 2 AN: 82988

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 45612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5732

European-Non Finnish (NFE) AF: 0.00000636 AC: 7 AN: 1100286

Other (OTH) AF: 0.0000168 AC: 1 AN: 59380

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152222 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74366

African (AFR) AF: 0.00 AC: 0 AN: 41456

American (AMR) AF: 0.00 AC: 0 AN: 15288

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5190

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10628

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68038

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000189

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary spastic paraplegia (1)
-	1	-	Hereditary spastic paraplegia 48 (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.7
Mutation Taster		=64/136	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1339701497; hg19: chr7-4825247;