chr7-75986177-CTAAAGCAAGACCGAGAGCACCTGT-C
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP5_Moderate
The NM_001395413.1(POR):c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT(p.Leu609_Trp617delinsArg) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L609L) has been classified as Likely benign.
Frequency
Consequence
NM_001395413.1 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Antley-Bixler syndrome with genital anomalies and disordered steroidogenesisInheritance: AR Classification: DEFINITIVE Submitted by: Ambry Genetics, ClinGen
- congenital adrenal hyperplasia due to cytochrome P450 oxidoreductase deficiencyInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
- Antley-Bixler syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001395413.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POR | MANE Select | c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT | p.Leu609_Trp617delinsArg | disruptive_inframe_deletion | Exon 15 of 16 | NP_001382342.1 | P16435 | ||
| POR | c.1880_1903delTAAAGCAAGACCGAGAGCACCTGT | p.Leu627_Trp635delinsArg | disruptive_inframe_deletion | Exon 16 of 17 | NP_001369584.2 | ||||
| POR | c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT | p.Leu609_Trp617delinsArg | disruptive_inframe_deletion | Exon 16 of 17 | NP_001354491.2 | P16435 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POR | TSL:1 MANE Select | c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT | p.Leu609_Trp617delinsArg | disruptive_inframe_deletion | Exon 15 of 16 | ENSP00000419970.2 | P16435 | ||
| POR | TSL:5 | c.1985_2008delTAAAGCAAGACCGAGAGCACCTGT | p.Leu662_Trp670delinsArg | disruptive_inframe_deletion | Exon 14 of 15 | ENSP00000393527.1 | H0Y4R2 | ||
| POR | c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT | p.Leu609_Trp617delinsArg | disruptive_inframe_deletion | Exon 15 of 16 | ENSP00000580607.1 |
Frequencies
GnomAD3 genomes Cov.: 34
GnomAD4 genome Cov.: 34
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.