rs786205876

Variant names:

• chr7-75986177-CTAAAGCAAGACCGAGAGCACCTGT-C
• rs786205876
• NM_001395413.1:c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP5_Moderate

The NM_001395413.1(POR):​c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT​(p.Leu609_Trp617delinsArg) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L609L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 34)
• Consequence: POR NM_001395413.1 disruptive_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 5.07
• Publications: 0 publications found

Genes affected

POR (HGNC:9208): (cytochrome p450 oxidoreductase) This gene encodes an endoplasmic reticulum membrane oxidoreductase that is essential for multiple metabolic processes, including reactions catalyzed by cytochrome P450 proteins for metabolism of steroid hormones, drugs and xenobiotics. The encoded protein has a flavin adenine dinucleotide (FAD)-binding domain and a flavodoxin-like domain which bind two cofactors, FAD and FMN, that allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene cause a complex set of disorders, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome, that resemble those caused by defects in steroid metabolizing enzymes such as aromatase, 21-hydroxylase, and 17 alpha-hydroxylase. [provided by RefSeq, Aug 2020]

POR Gene-Disease associations (from GenCC):

• Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Ambry Genetics
• congenital adrenal hyperplasia due to cytochrome P450 oxidoreductase deficiency

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
• Antley-Bixler syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 3 uncertain in NM_001395413.1
• PM4: Nonframeshift variant in NON repetitive region in NM_001395413.1.
• PP5: Variant 7-75986177-CTAAAGCAAGACCGAGAGCACCTGT-C is Pathogenic according to our data. Variant chr7-75986177-CTAAAGCAAGACCGAGAGCACCTGT-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 16912.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001395413.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POR	NM_001395413.1	MANE Select	c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT	p.Leu609_Trp617delinsArg	disruptive_inframe_deletion	Exon 15 of 16	NP_001382342.1	P16435
	POR	NM_001382655.3		c.1880_1903delTAAAGCAAGACCGAGAGCACCTGT	p.Leu627_Trp635delinsArg	disruptive_inframe_deletion	Exon 16 of 17	NP_001369584.2
	POR	NM_001367562.3		c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT	p.Leu609_Trp617delinsArg	disruptive_inframe_deletion	Exon 16 of 17	NP_001354491.2	P16435

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POR	ENST00000461988.6	TSL:1 MANE Select	c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT	p.Leu609_Trp617delinsArg	disruptive_inframe_deletion	Exon 15 of 16	ENSP00000419970.2	P16435
	POR	ENST00000447222.5	TSL:5	c.1985_2008delTAAAGCAAGACCGAGAGCACCTGT	p.Leu662_Trp670delinsArg	disruptive_inframe_deletion	Exon 14 of 15	ENSP00000393527.1	H0Y4R2
	POR	ENST00000910548.1		c.1826_1849delTAAAGCAAGACCGAGAGCACCTGT	p.Leu609_Trp617delinsArg	disruptive_inframe_deletion	Exon 15 of 16	ENSP00000580607.1

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis (1)
1	-	-	Congenital adrenal hyperplasia due to cytochrome P450 oxidoreductase deficiency;C3150099:Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.1
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786205876; hg19: chr7-75615495;