chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C

Variant names:

• chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C
• rs3216902
• NM_000089.4:c.2350-124_2350-87delACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_000089.4(COL1A2):​c.2350-124_2350-87delACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.362 in 1,160,680 control chromosomes in the GnomAD database, including 64,998 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.24 (5245 hom., cov: 24)
  • Exomes 𝑓: 0.38 (59753 hom.)
• Consequence: COL1A2 NM_000089.4 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.20
• Publications: 3 publications found

Genes affected

COL1A2 (HGNC:2198): (collagen type I alpha 2 chain) This gene encodes the pro-alpha2 chain of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIB, recessive Ehlers-Danlos syndrome Classical type, idiopathic osteoporosis, and atypical Marfan syndrome. Symptoms associated with mutations in this gene, however, tend to be less severe than mutations in the gene for the alpha1 chain of type I collagen (COL1A1) reflecting the different role of alpha2 chains in matrix integrity. Three transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]

COL1A2 Gene-Disease associations (from GenCC):

• Ehlers-Danlos syndrome, arthrochalasia type, 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Illumina, PanelApp Australia, Labcorp Genetics (formerly Invitae)
• osteogenesis imperfecta

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• osteogenesis imperfecta type 1

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• osteogenesis imperfecta type 2

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P, ClinGen
• osteogenesis imperfecta type 3

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
• osteogenesis imperfecta type 4

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Ehlers-Danlos syndrome, arthrochalasia type

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
• Ehlers-Danlos syndrome, cardiac valvular type

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, PanelApp Australia, Orphanet, G2P
• combined osteogenesis imperfecta and Ehlers-Danlos syndrome 2

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen, Ambry Genetics
• Ehlers-Danlos/osteogenesis imperfecta syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• high bone mass osteogenesis imperfecta

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is Benign according to our data. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in CliVar as Benign. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in CliVar as Benign. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in CliVar as Benign. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in CliVar as Benign. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in CliVar as Benign. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in CliVar as Benign. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in CliVar as Benign. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in CliVar as Benign. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in CliVar as Benign. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.307 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COL1A2	NM_000089.4	c.2350-124_2350-87delACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT		intron_variant	Intron 38 of 51	ENST00000297268.11	NP_000080.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COL1A2	ENST00000297268.11	c.2350-126_2350-89delCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA		intron_variant	Intron 38 of 51	1	NM_000089.4	ENSP00000297268.6
COL1A2	ENST00000473573.5	n.687-126_687-89delCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA		intron_variant	Intron 10 of 10	2
COL1A2	ENST00000497316.5	n.747-126_747-89delCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA		intron_variant	Intron 7 of 8	2

Frequencies

GnomAD3 genomes AF: 0.237 AC: 35891 AN: 151702 Hom.: 5247 Cov.: 24

Gnomad AFR AF: 0.0611

Gnomad AMI AF: 0.279

Gnomad AMR AF: 0.255

Gnomad ASJ AF: 0.282

Gnomad EAS AF: 0.255

Gnomad SAS AF: 0.277

Gnomad FIN AF: 0.378

Gnomad MID AF: 0.252

Gnomad NFE AF: 0.311

Gnomad OTH AF: 0.231

GnomAD4 exome AF: 0.381 AC: 384410 AN: 1008860 Hom.: 59753 AF XY: 0.375 AC XY: 194608 AN XY: 519088

African (AFR) AF: 0.0733 AC: 1472 AN: 20070

American (AMR) AF: 0.261 AC: 10752 AN: 41134

Ashkenazi Jewish (ASJ) AF: 0.318 AC: 7259 AN: 22820

East Asian (EAS) AF: 0.274 AC: 10095 AN: 36840

South Asian (SAS) AF: 0.314 AC: 23368 AN: 74450

European-Finnish (FIN) AF: 0.376 AC: 19554 AN: 51966

Middle Eastern (MID) AF: 0.269 AC: 1285 AN: 4774

European-Non Finnish (NFE) AF: 0.415 AC: 295372 AN: 711850

Other (OTH) AF: 0.339 AC: 15253 AN: 44956

GnomAD4 genome AF: 0.236 AC: 35877 AN: 151820 Hom.: 5245 Cov.: 24 AF XY: 0.241 AC XY: 17853 AN XY: 74170

African (AFR) AF: 0.0609 AC: 2528 AN: 41508

American (AMR) AF: 0.255 AC: 3890 AN: 15236

Ashkenazi Jewish (ASJ) AF: 0.282 AC: 975 AN: 3460

East Asian (EAS) AF: 0.255 AC: 1310 AN: 5142

South Asian (SAS) AF: 0.276 AC: 1327 AN: 4808

European-Finnish (FIN) AF: 0.378 AC: 3976 AN: 10520

Middle Eastern (MID) AF: 0.247 AC: 72 AN: 292

European-Non Finnish (NFE) AF: 0.311 AC: 21065 AN: 67836

Other (OTH) AF: 0.228 AC: 480 AN: 2108

Alfa AF: 0.256 Hom.: 604

Asia WGS AF: 0.232 AC: 806 AN: 3478

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Jun 28, 2018

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.2
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3216902; hg19: chr7-94051084; COSMIC: COSV51952572; COSMIC: COSV51952572;