chr8-133238956-CCCCTCGCTGGTGTGCGAGCGGCTGCGGGTG-C
Variant summary
Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3
The NM_006096.4(NDRG1):c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG(p.Thr360_Gly369del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000824 in 1,578,332 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_006096.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 5 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000198 AC: 3AN: 151858Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.0000106 AC: 2AN: 188768Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 101502
GnomAD4 exome AF: 0.00000701 AC: 10AN: 1426474Hom.: 0 AF XY: 0.00000425 AC XY: 3AN XY: 706090
GnomAD4 genome AF: 0.0000198 AC: 3AN: 151858Hom.: 0 Cov.: 32 AF XY: 0.0000270 AC XY: 2AN XY: 74158
ClinVar
Submissions by phenotype
Charcot-Marie-Tooth disease type 4 Uncertain:1
This variant, c.1077_1106del, results in the deletion of 10 amino acid(s) of the NDRG1 protein (p.Thr360_Gly369del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with NDRG1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at