rs1554747463

Variant names:

• chr8-133238956-CCCCTCGCTGGTGTGCGAGCGGCTGCGGGTG-C
• rs1554747463
• NM_006096.4:c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG

Your query was ambiguous. Multiple possible variants found:

• chr8-133238956-CCCCTCGCTGGTGTGCGAGCGGCTGCGGGTG-C
• chr8-133238956-CCCCTCGCTGGTGTGCGAGCGGCTGCGGGTG-CCCCTCGCTGGTGTGCGAGCGGCTGCGGGTGCCCTCGCTGGTGTGCGAGCGGCTGCGGGTG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_006096.4(NDRG1):​c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG​(p.Thr360_Gly369del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000824 in 1,578,332 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000070 (0 hom.)
• Consequence: NDRG1 NM_006096.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.58
• Publications: 0 publications found

Genes affected

NDRG1 (HGNC:7679): (N-myc downstream regulated 1) This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]

NDRG1 Gene-Disease associations (from GenCC):

• Charcot-Marie-Tooth disease type 4D

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Illumina

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006096.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006096.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NDRG1	NM_006096.4	MANE Select	c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG	p.Thr360_Gly369del	disruptive_inframe_deletion	Exon 16 of 16	NP_006087.2
	NDRG1	NM_001374844.1		c.1128_1157delCACCCGCAGCCGCTCGCACACCAGCGAGGG	p.Thr377_Gly386del	disruptive_inframe_deletion	Exon 16 of 16	NP_001361773.1
	NDRG1	NM_001135242.2		c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG	p.Thr360_Gly369del	disruptive_inframe_deletion	Exon 16 of 16	NP_001128714.1	Q92597-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NDRG1	ENST00000323851.13	TSL:1 MANE Select	c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG	p.Thr360_Gly369del	disruptive_inframe_deletion	Exon 16 of 16	ENSP00000319977.8	Q92597-1
	NDRG1	ENST00000522476.5	TSL:1	c.879_908delCACCCGCAGCCGCTCGCACACCAGCGAGGG	p.Thr294_Gly303del	disruptive_inframe_deletion	Exon 14 of 14	ENSP00000427894.1	Q92597-2
	NDRG1	ENST00000414097.6	TSL:2	c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG	p.Thr360_Gly369del	disruptive_inframe_deletion	Exon 16 of 16	ENSP00000404854.2	Q92597-1

Frequencies

GnomAD3 genomes AF: 0.0000198 AC: 3 AN: 151858 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000727

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000106 AC: 2 AN: 188768 AF XY: 0.00

Gnomad AFR exome AF: 0.0000915

Gnomad AMR exome AF: 0.0000366

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000701 AC: 10 AN: 1426474 Hom.: 0 AF XY: 0.00000425 AC XY: 3 AN XY: 706090

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000907 AC: 3 AN: 33064

American (AMR) AF: 0.0000260 AC: 1 AN: 38438

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25396

East Asian (EAS) AF: 0.00 AC: 0 AN: 38354

South Asian (SAS) AF: 0.0000246 AC: 2 AN: 81264

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49992

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5602

European-Non Finnish (NFE) AF: 0.00000183 AC: 2 AN: 1095326

Other (OTH) AF: 0.0000339 AC: 2 AN: 59038

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000250517), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000198 AC: 3 AN: 151858 Hom.: 0 Cov.: 32 AF XY: 0.0000270 AC XY: 2 AN XY: 74158

African (AFR) AF: 0.0000727 AC: 3 AN: 41240

American (AMR) AF: 0.00 AC: 0 AN: 15242

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5180

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10596

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67986

Other (OTH) AF: 0.00 AC: 0 AN: 2094

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Charcot-Marie-Tooth disease type 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.6
Mutation Taster		=146/54	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554747463; hg19: chr8-134251199;