chr8-144512622-ACTGGGCAGGGCGTGCTTACCTGTGGGCCAGGGCCTGGAG-A

Variant names:

• chr8-144512622-ACTGGGCAGGGCGTGCTTACCTGTGGGCCAGGGCCTGGAG-A
• rs1554897134
• NM_004260.4:c.2866_2885+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_004260.4(RECQL4):​c.2866_2885+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG​(p.Leu956fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000206 in 1,459,606 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L956L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 34)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: RECQL4 NM_004260.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.352
• Publications: 0 publications found

Genes affected

RECQL4 (HGNC:9949): (RecQ like helicase 4) The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]

RECQL4 Gene-Disease associations (from GenCC):

• Baller-Gerold syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, G2P, Orphanet
• Rothmund-Thomson syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Rothmund-Thomson syndrome type 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, G2P
• osteosarcoma

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
• rapadilino syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp

ENSG00000265393 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-144512622-ACTGGGCAGGGCGTGCTTACCTGTGGGCCAGGGCCTGGAG-A is Pathogenic according to our data. Variant chr8-144512622-ACTGGGCAGGGCGTGCTTACCTGTGGGCCAGGGCCTGGAG-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 459438.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RECQL4	NM_004260.4	c.2866_2885+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG	p.Leu956fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 16 of 21	ENST00000617875.6	NP_004251.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RECQL4	ENST00000617875.6	c.2866_2885+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG	p.Leu956fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 16 of 21	1	NM_004260.4	ENSP00000482313.2

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD2 exomes AF: 0.00000405 AC: 1 AN: 247200 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000557

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000206 AC: 3 AN: 1459606 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 725946

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33466

American (AMR) AF: 0.00 AC: 0 AN: 44700

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26126

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39674

South Asian (SAS) AF: 0.00 AC: 0 AN: 86248

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52056

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111252

Other (OTH) AF: 0.00 AC: 0 AN: 60318

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000000000000888178), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 34

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Baller-Gerold syndrome Pathogenic:1

Jul 10, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is present in population databases (no rsID available, gnomAD 0.006%). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 459438). This variant has not been reported in the literature in individuals affected with RECQL4-related conditions. This variant results in the deletion of part of exon 16 (c.2866_2885+19del) of the RECQL4 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in RECQL4 are known to be pathogenic (PMID: 12734318, 12952869). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.35
Mutation Taster		=20/180	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554897134; hg19: chr8-145738005;