rs1554897134

Variant names:

• chr8-144512622-ACTGGGCAGGGCGTGCTTACCTGTGGGCCAGGGCCTGGAG-A
• rs1554897134
• NM_004260.4:c.2866_2885+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_004260.4(RECQL4):​c.2866_2885+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG​(p.Leu956fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000206 in 1,459,606 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L956L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 34)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: RECQL4 NM_004260.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.352
• Publications: 0 publications found

Genes affected

RECQL4 (HGNC:9949): (RecQ like helicase 4) The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]

RECQL4 Gene-Disease associations (from GenCC):

• Baller-Gerold syndrome

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• Rothmund-Thomson syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Rothmund-Thomson syndrome type 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, G2P
• osteosarcoma

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
• rapadilino syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• congenital heart disease

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000265393 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-144512622-ACTGGGCAGGGCGTGCTTACCTGTGGGCCAGGGCCTGGAG-A is Pathogenic according to our data. Variant chr8-144512622-ACTGGGCAGGGCGTGCTTACCTGTGGGCCAGGGCCTGGAG-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 459438.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004260.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RECQL4	NM_004260.4	MANE Select	c.2866_2885+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG	p.Leu956fs	frameshift splice_donor splice_region intron	Exon 16 of 21	NP_004251.4	O94761
	RECQL4	NM_001413019.1		c.2941_2960+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG	p.Leu981fs	frameshift splice_donor splice_region intron	Exon 15 of 20	NP_001399948.1
	RECQL4	NM_001413036.1		c.2866_2885+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG	p.Leu956fs	frameshift splice_donor splice_region intron	Exon 16 of 21	NP_001399965.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RECQL4	ENST00000617875.6	TSL:1 MANE Select	c.2866_2885+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG	p.Leu956fs	frameshift splice_donor splice_region intron	Exon 16 of 21	ENSP00000482313.2	O94761
	RECQL4	ENST00000621189.4	TSL:1	c.1795_1814+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG	p.Leu599fs	frameshift splice_donor splice_region intron	Exon 15 of 20	ENSP00000483145.1	A0A087X072
	RECQL4	ENST00000971710.1		c.2773_2792+19delCTCCAGGCCCTGGCCCACAGGTAAGCACGCCCTGCCCAG	p.Leu925fs	frameshift splice_donor splice_region intron	Exon 16 of 21	ENSP00000641769.1

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD2 exomes AF: 0.00000405 AC: 1 AN: 247200 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000557

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000206 AC: 3 AN: 1459606 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 725946

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33466

American (AMR) AF: 0.00 AC: 0 AN: 44700

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26126

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39674

South Asian (SAS) AF: 0.00 AC: 0 AN: 86248

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52056

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111252

Other (OTH) AF: 0.00 AC: 0 AN: 60318

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000000000000888178), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 34

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Baller-Gerold syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.35
Mutation Taster		=20/180	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554897134; hg19: chr8-145738005;