chr9-137233909-AGAACAGCACAGCCCCGGCGGACAGGCTGCCCTGTGAGGCCCGGCCCACCCCAAGCCCCCTACACCCCCCACACTCCCCCTCACCGGCCCCTACATGGAGAG-A

Position:

• chr9-137233909-AGAACAGCACAGCCCCGGCGGACAGGCTGCCCTGTGAGGCCCGGCCCACCCCAAGCCCCCTACACCCCCCACACTCCCCCTCACCGGCCCCTACATGGAGAG-A

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PP5_Very_Strong

The NM_001177316.2(SLC34A3):​c.925+20_926-48del variant causes a intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.00028 (0 hom., cov: 27)
  • Exomes 𝑓: 0.00029 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: SLC34A3 NM_001177316.2 intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 2.03

Genes affected

SLC34A3 (HGNC:20305): (solute carrier family 34 member 3) This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PP5: Variant 9-137233909-AGAACAGCACAGCCCCGGCGGACAGGCTGCCCTGTGAGGCCCGGCCCACCCCAAGCCCCCTACACCCCCCACACTCCCCCTCACCGGCCCCTACATGGAGAG-A is Pathogenic according to our data. Variant chr9-137233909-AGAACAGCACAGCCCCGGCGGACAGGCTGCCCTGTGAGGCCCGGCCCACCCCAAGCCCCCTACACCCCCCACACTCCCCCTCACCGGCCCCTACATGGAGAG-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1433.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SLC34A3	NM_001177316.2	c.925+20_926-48del		intron_variant		ENST00000673835.1	NP_001170787.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SLC34A3	ENST00000673835.1	c.925+20_926-48del		intron_variant			NM_001177316.2	ENSP00000501114.1
SLC34A3	ENST00000361134.2	c.925+20_926-48del		intron_variant		2		ENSP00000355353.2
SLC34A3	ENST00000538474.5	c.925+20_926-48del		intron_variant		5		ENSP00000442397.1
SLC34A3	ENST00000673865.1	c.925+20_926-48del		intron_variant				ENSP00000501101.1

Frequencies

GnomAD3 genomes AF: 0.00 AC: 43 AN: 151532 Hom.: 0 Cov.: 27 FAILED QC

Gnomad AFR AF: 0.000146

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000263

Gnomad ASJ AF: 0.000577

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000834

Gnomad FIN AF: 0.000378

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000339

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000294 AC: 427 AN: 1452014 Hom.: 0 AF XY: 0.000315 AC XY: 227 AN XY: 721550

Gnomad4 AFR exome AF: 0.000210

Gnomad4 AMR exome AF: 0.000701

Gnomad4 ASJ exome AF: 0.000308

Gnomad4 EAS exome AF: 0.000609

Gnomad4 SAS exome AF: 0.000330

Gnomad4 FIN exome AF: 0.000117

Gnomad4 NFE exome AF: 0.000281

Gnomad4 OTH exome AF: 0.000200

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.000284 AC: 43 AN: 151640 Hom.: 0 Cov.: 27 AF XY: 0.000391 AC XY: 29 AN XY: 74126

Gnomad4 AFR AF: 0.000145

Gnomad4 AMR AF: 0.000262

Gnomad4 ASJ AF: 0.000577

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000834

Gnomad4 FIN AF: 0.000378

Gnomad4 NFE AF: 0.000339

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000447 Hom.: 0

Asia WGS AF: 0.000290 AC: 1 AN: 3460

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Autosomal recessive hypophosphatemic bone disease Pathogenic:4

Pathogenic, no assertion criteria provided	literature only	OMIM	Oct 01, 2006	- -
Pathogenic, criteria provided, single submitter	clinical testing	Institute of Human Genetics Munich, Klinikum Rechts Der Isar, TU München	Sep 30, 2017	- -
Pathogenic, criteria provided, single submitter	clinical testing	3billion	Sep 01, 2022	The variant is observed at an extremely low frequency in the gnomAD v2.1.1 dataset (total allele frequency: 0.003%). This variant on the canonical splice site is predicted to alter splicing and result in a loss or disruption of normal protein function. Multiple pathogenic loss-of-function variants are reported downstream of the variant. The variant has been reported at least twice as pathogenic without evidence for the classification (ClinVar ID: VCV000001433). Therefore, this variant is classified as Pathogenic according to the recommendation of ACMG/AMP guideline. -
Likely pathogenic, criteria provided, single submitter	clinical testing	Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center	Jan 19, 2023	PM3_Strong, PM4, PS3_Supporting -

not provided Pathogenic:2

Likely pathogenic, criteria provided, single submitter	clinical testing	GeneDx	Aug 10, 2022	RNA studies indicate that this variant leads to an in-frame inclusion of 22 additional amino acids (Ichikawa et al., 2006); Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 16849419, 33502066, 29809158, 32472541, 16358214, 32963591, 26543054, 34721296, 31672324, 30765103) -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 18, 2024	This sequence change falls in intron 9 of the SLC34A3 gene. It does not directly change the encoded amino acid sequence of the SLC34A3 protein. RNA analysis indicates that this variant induces altered splicing and likely results in the gain of 22 amino acid residue(s), but is expected to preserve the integrity of the reading-frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has been observed in individual(s) with hereditary hypophosphatemic rickets with hypercalciuria (PMID: 16358214, 16849419, 29809158). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. It has also been observed to segregate with disease in related individuals. This variant is also known as g.2259-2359del. ClinVar contains an entry for this variant (Variation ID: 1433). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Studies have shown that this variant results in the activation of a cryptic splice site in intron 9 (PMID: 16849419). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554784044; hg19: chr9-140128361;