rs1554784044

Variant names:

• chr9-137233909-AGAACAGCACAGCCCCGGCGGACAGGCTGCCCTGTGAGGCCCGGCCCACCCCAAGCCCCCTACACCCCCCACACTCCCCCTCACCGGCCCCTACATGGAGAG-A
• rs1554784044
• NM_001177316.2:c.925+20_926-48del

Variant summary

Our verdict is Pathogenic. The variant received 20 ACMG points: 20P and 0B. PVS1 PS3 PP5_Very_Strong

The ENST00000673835.1(SLC34A3):​c.894_925+69del​(p.Asn299AsnfsTer261) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV003932235: PS3_Supporting" and additional evidence is available in ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.00028 (0 hom., cov: 27)
  • Exomes 𝑓: 0.00029 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: SLC34A3 ENST00000673835.1 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 2.03
• Publications: 1 publications found

Genes affected

SLC34A3 (HGNC:20305): (solute carrier family 34 member 3) This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]

SLC34A3 Gene-Disease associations (from GenCC):

• hereditary hypophosphatemic rickets with hypercalciuria

  Inheritance: AR, SD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, PanelApp Australia, Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 20 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PS3: PS3 evidence extracted from ClinVar submissions: SCV003932235: PS3_Supporting; SCV001387445: Studies have shown that this variant results in the activation of a cryptic splice site in intron 9 (PMID: 16849419).
• PP5: Variant 9-137233909-AGAACAGCACAGCCCCGGCGGACAGGCTGCCCTGTGAGGCCCGGCCCACCCCAAGCCCCCTACACCCCCCACACTCCCCCTCACCGGCCCCTACATGGAGAG-A is Pathogenic according to our data. Variant chr9-137233909-AGAACAGCACAGCCCCGGCGGACAGGCTGCCCTGTGAGGCCCGGCCCACCCCAAGCCCCCTACACCCCCCACACTCCCCCTCACCGGCCCCTACATGGAGAG-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 1433.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000673835.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC34A3	NM_001177316.2	MANE Select	c.925+20_926-48del		intron	N/A	NP_001170787.2	Q8N130
	SLC34A3	NM_001177317.2		c.925+20_926-48del		intron	N/A	NP_001170788.2	Q8N130
	SLC34A3	NM_080877.3		c.925+20_926-48del		intron	N/A	NP_543153.2	Q8N130

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC34A3	ENST00000673835.1	MANE Select	c.894_925+69del	p.Asn299AsnfsTer261	frameshift splice_donor splice_region intron	Exon 9 of 13	ENSP00000501114.1	Q8N130
	SLC34A3	ENST00000361134.2	TSL:2	c.894_925+69del	p.Asn299AsnfsTer261	frameshift splice_donor splice_region intron	Exon 9 of 13	ENSP00000355353.2	Q8N130
	SLC34A3	ENST00000538474.5	TSL:5	c.894_925+69del	p.Asn299AsnfsTer261	frameshift splice_donor splice_region intron	Exon 9 of 13	ENSP00000442397.1	Q8N130

Frequencies

GnomAD3 genomes AF: 0.000284 AC: 43 AN: 151532 Hom.: 0 Cov.: 27

Gnomad AFR AF: 0.000146

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000263

Gnomad ASJ AF: 0.000577

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000834

Gnomad FIN AF: 0.000378

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000339

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000129 AC: 3 AN: 232260 AF XY: 0.00000785

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000297

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000964

Gnomad OTH exome AF: 0.000176

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000294 AC: 427 AN: 1452014 Hom.: 0 AF XY: 0.000315 AC XY: 227 AN XY: 721550

African (AFR) AF: 0.000210 AC: 7 AN: 33306

American (AMR) AF: 0.000701 AC: 31 AN: 44236

Ashkenazi Jewish (ASJ) AF: 0.000308 AC: 8 AN: 25960

East Asian (EAS) AF: 0.000609 AC: 24 AN: 39422

South Asian (SAS) AF: 0.000330 AC: 28 AN: 84832

European-Finnish (FIN) AF: 0.000117 AC: 6 AN: 51230

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4684

European-Non Finnish (NFE) AF: 0.000281 AC: 311 AN: 1108440

Other (OTH) AF: 0.000200 AC: 12 AN: 59904

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.000284 AC: 43 AN: 151640 Hom.: 0 Cov.: 27 AF XY: 0.000391 AC XY: 29 AN XY: 74126

African (AFR) AF: 0.000145 AC: 6 AN: 41336

American (AMR) AF: 0.000262 AC: 4 AN: 15252

Ashkenazi Jewish (ASJ) AF: 0.000577 AC: 2 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5122

South Asian (SAS) AF: 0.000834 AC: 4 AN: 4794

European-Finnish (FIN) AF: 0.000378 AC: 4 AN: 10574

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.000339 AC: 23 AN: 67790

Other (OTH) AF: 0.00 AC: 0 AN: 2104

Alfa AF: 0.000447 Hom.: 0

Asia WGS AF: 0.000290 AC: 1 AN: 3460

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
4	-	-	Autosomal recessive hypophosphatemic bone disease (4)
2	-	-	not provided (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=68/132	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554784044; hg19: chr9-140128361;