chrX-100403522-A-ACCTCTTTCCCCTTAGGCTCACTTTCTC

Variant names:

• chrX-100403522-A-ACCTCTTTCCCCTTAGGCTCACTTTCTC
• rs779136255
• NM_001184880.2:c.2263_2288+1dupGAGAAAGTGAGCCTAAGGGGAAAGAGG

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PVS1_Moderate BS2

The NM_001184880.2(PCDH19):​c.2263_2288+1dupGAGAAAGTGAGCCTAAGGGGAAAGAGG variant causes a splice donor, intron change. The variant allele was found at a frequency of 0.0000317 in 1,200,396 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 11 hemizygotes in GnomAD. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000018 (0 hom., 1 hem., cov: 23)
  • Exomes 𝑓: 0.000033 (0 hom. 10 hem.)
• Consequence: PCDH19 NM_001184880.2 splice_donor, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.91

Genes affected

PCDH19 (HGNC:14270): (protocadherin 19) The protein encoded by this gene is a member of the delta-2 protocadherin subclass of the cadherin superfamily. The encoded protein is thought to be a calcium-dependent cell-adhesion protein that is primarily expressed in the brain. Mutations in this gene on human chromosome X are associated with sporadic infantile epileptic encephalopathy and to a female-restricted form of epilepsy (EFMR; also known as PCDH19RE). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.040905137 fraction of the gene. Cryptic splice site detected, with MaxEntScore 5.9, offset of 7, new splice context is: aaaGTgagc. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• BS2: High Hemizygotes in GnomAdExome4 at 10 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PCDH19	NM_001184880.2	c.2263_2288+1dupGAGAAAGTGAGCCTAAGGGGAAAGAGG		splice_donor_variant, intron_variant	Intron 2 of 5	ENST00000373034.8	NP_001171809.1
PCDH19	NM_001105243.2	c.2148-698_2148-672dupGAGAAAGTGAGCCTAAGGGGAAAGAGG		intron_variant	Intron 1 of 4		NP_001098713.1
PCDH19	NM_020766.3	c.2148-698_2148-672dupGAGAAAGTGAGCCTAAGGGGAAAGAGG		intron_variant	Intron 1 of 4		NP_065817.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PCDH19	ENST00000373034.8	c.2288+1_2288+2insGAGAAAGTGAGCCTAAGGGGAAAGAGG		splice_donor_variant, intron_variant	Intron 2 of 5	1	NM_001184880.2	ENSP00000362125.4
PCDH19	ENST00000255531.8	c.2148-672_2148-671insGAGAAAGTGAGCCTAAGGGGAAAGAGG		intron_variant	Intron 1 of 4	1		ENSP00000255531.7
PCDH19	ENST00000420881.6	c.2148-672_2148-671insGAGAAAGTGAGCCTAAGGGGAAAGAGG		intron_variant	Intron 1 of 4	1		ENSP00000400327.2
PCDH19	ENST00000636150.1	c.66-948_66-947insGAGAAAGTGAGCCTAAGGGGAAAGAGG		intron_variant	Intron 1 of 2	5		ENSP00000490463.1

Frequencies

GnomAD3 genomes AF: 0.0000184 AC: 2 AN: 108773 Hom.: 0 Cov.: 23 AF XY: 0.0000315 AC XY: 1 AN XY: 31743

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000381

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.00000582 AC: 1 AN: 171722 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 63570

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000133

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000330 AC: 36 AN: 1091623 Hom.: 0 Cov.: 31 AF XY: 0.0000278 AC XY: 10 AN XY: 359203

Gnomad4 AFR exome AF: 0.0000382

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000393

Gnomad4 OTH exome AF: 0.0000437

GnomAD4 genome AF: 0.0000184 AC: 2 AN: 108773 Hom.: 0 Cov.: 23 AF XY: 0.0000315 AC XY: 1 AN XY: 31743

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000381

Gnomad4 OTH AF: 0.00

Bravo AF: 0.00000756

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Developmental and epileptic encephalopathy, 9 Uncertain:1

Jan 23, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.2262_2288dup, results in the insertion of 9 amino acid(s) of the PCDH19 protein (p.Glu755_Arg763dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs779136255, gnomAD 0.001%). This variant has been observed in individual(s) with clinical features of PCDH19-related conditions (internal data). This variant is also known as c.2263_2288+1dup. ClinVar contains an entry for this variant (Variation ID: 533850). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs779136255; hg19: chrX-99658520;