rs779136255

Variant names:

• chrX-100403522-A-ACCTCTTTCCCCTTAGGCTCACTTTCTC
• rs779136255
• NM_001184880.2:c.2263_2288+1dupGAGAAAGTGAGCCTAAGGGGAAAGAGG

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 2P and 4B. PVS1_Moderate BS2

The NM_001184880.2(PCDH19):​c.2263_2288+1dupGAGAAAGTGAGCCTAAGGGGAAAGAGG variant causes a splice donor, intron change. The variant allele was found at a frequency of 0.0000317 in 1,200,396 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 11 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000018 (0 hom., 1 hem., cov: 23)
  • Exomes 𝑓: 0.000033 (0 hom. 10 hem.)
• Consequence: PCDH19 NM_001184880.2 splice_donor, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.91
• Publications: 0 publications found

Genes affected

PCDH19 (HGNC:14270): (protocadherin 19) The protein encoded by this gene is a member of the delta-2 protocadherin subclass of the cadherin superfamily. The encoded protein is thought to be a calcium-dependent cell-adhesion protein that is primarily expressed in the brain. Mutations in this gene on human chromosome X are associated with sporadic infantile epileptic encephalopathy and to a female-restricted form of epilepsy (EFMR; also known as PCDH19RE). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]

PCDH19 Gene-Disease associations (from GenCC):

• developmental and epileptic encephalopathy, 9

  Inheritance: XL, Unknown Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, G2P, Labcorp Genetics (formerly Invitae)
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• Dravet syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.040905137 fraction of the gene. Cryptic splice site detected, with MaxEntScore 5.9, offset of 7, new splice context is: aaaGTgagc. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• BS2: High AC in GnomAdExome4 at 36 XL,Unknown,AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001184880.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PCDH19	NM_001184880.2	MANE Select	c.2263_2288+1dupGAGAAAGTGAGCCTAAGGGGAAAGAGG		splice_donor intron	N/A	NP_001171809.1	Q8TAB3-1
	PCDH19	NM_001105243.2		c.2148-698_2148-672dupGAGAAAGTGAGCCTAAGGGGAAAGAGG		intron	N/A	NP_001098713.1	Q8TAB3-2
	PCDH19	NM_020766.3		c.2148-698_2148-672dupGAGAAAGTGAGCCTAAGGGGAAAGAGG		intron	N/A	NP_065817.2	Q8TAB3-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PCDH19	ENST00000373034.8	TSL:1 MANE Select	c.2288+1_2288+2insGAGAAAGTGAGCCTAAGGGGAAAGAGG		splice_donor intron	N/A	ENSP00000362125.4	Q8TAB3-1
	PCDH19	ENST00000255531.8	TSL:1	c.2148-672_2148-671insGAGAAAGTGAGCCTAAGGGGAAAGAGG		intron	N/A	ENSP00000255531.7	Q8TAB3-2
	PCDH19	ENST00000420881.6	TSL:1	c.2148-672_2148-671insGAGAAAGTGAGCCTAAGGGGAAAGAGG		intron	N/A	ENSP00000400327.2	Q8TAB3-3

Frequencies

GnomAD3 genomes AF: 0.0000184 AC: 2 AN: 108773 Hom.: 0 Cov.: 23

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000381

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000582 AC: 1 AN: 171722 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000133

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000330 AC: 36 AN: 1091623 Hom.: 0 Cov.: 31 AF XY: 0.0000278 AC XY: 10 AN XY: 359203

African (AFR) AF: 0.0000382 AC: 1 AN: 26144

American (AMR) AF: 0.00 AC: 0 AN: 34656

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19258

East Asian (EAS) AF: 0.00 AC: 0 AN: 29775

South Asian (SAS) AF: 0.00 AC: 0 AN: 53385

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 39562

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3338

European-Non Finnish (NFE) AF: 0.0000393 AC: 33 AN: 839722

Other (OTH) AF: 0.0000437 AC: 2 AN: 45783

GnomAD4 genome AF: 0.0000184 AC: 2 AN: 108773 Hom.: 0 Cov.: 23 AF XY: 0.0000315 AC XY: 1 AN XY: 31743

African (AFR) AF: 0.00 AC: 0 AN: 29695

American (AMR) AF: 0.00 AC: 0 AN: 10022

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2629

East Asian (EAS) AF: 0.00 AC: 0 AN: 3435

South Asian (SAS) AF: 0.00 AC: 0 AN: 2516

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 5638

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 226

European-Non Finnish (NFE) AF: 0.0000381 AC: 2 AN: 52475

Other (OTH) AF: 0.00 AC: 0 AN: 1461

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Developmental and epileptic encephalopathy, 9 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.9
Mutation Taster		=57/43	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs779136255; hg19: chrX-99658520;