chrX-150663502-TTCTATACTAAAGAAATCAATCGAGTTT-AACTGGA
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP3PP5
The NM_000252.3(MTM1):c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA(p.Phe513_Leu522delinsAsnTrpIle) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). The gene MTM1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000252.3 missense, disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- X-linked myotubular myopathyInheritance: XL Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, G2P, Myriad Women’s Health, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000252.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MTM1 | MANE Select | c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA | p.Phe513_Leu522delinsAsnTrpIle | missense disruptive_inframe_deletion | N/A | NP_000243.1 | Q13496-1 | ||
| MTM1 | c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA | p.Phe513_Leu522delinsAsnTrpIle | missense disruptive_inframe_deletion | N/A | NP_001363837.1 | Q13496-1 | |||
| MTM1 | c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA | p.Phe513_Leu522delinsAsnTrpIle | missense disruptive_inframe_deletion | N/A | NP_001363835.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MTM1 | TSL:1 MANE Select | c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA | p.Phe513_Leu522delinsAsnTrpIle | missense disruptive_inframe_deletion | N/A | ENSP00000359423.3 | Q13496-1 | ||
| MTM1 | c.1582_1609delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA | p.Phe528_Leu537delinsAsnTrpIle | missense disruptive_inframe_deletion | N/A | ENSP00000510607.1 | A0A8I5KZ76 | |||
| MTM1 | c.1582_1609delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA | p.Phe528_Leu537delinsAsnTrpIle | missense disruptive_inframe_deletion | N/A | ENSP00000536517.1 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at