rs398123271

Variant names:

• chrX-150663502-TTCTATACTAAAGAAATCAATCGAGTTT-AACTGGA
• rs398123271
• NM_000252.3:c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP3 PP5

The NM_000252.3(MTM1):​c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA​(p.Phe513_Leu522delinsAsnTrpIle) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). The gene MTM1 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 23)
• Consequence: MTM1 NM_000252.3 missense, disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 8.90
• Publications: 0 publications found

Genes affected

MTM1 (HGNC:7448): (myotubularin 1) This gene encodes a dual-specificity phosphatase that acts on both phosphotyrosine and phosphoserine. It is required for muscle cell differentiation and mutations in this gene have been identified as being responsible for X-linked myotubular myopathy. [provided by RefSeq, Jul 2008]

MTM1 Gene-Disease associations (from GenCC):

• X-linked myotubular myopathy

  Inheritance: XL Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, G2P, Myriad Women’s Health, Ambry Genetics

ACMG classification

Specifications for MTM1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000252.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-150663502-TTCTATACTAAAGAAATCAATCGAGTTT-AACTGGA is Pathogenic according to our data. Variant chrX-150663502-TTCTATACTAAAGAAATCAATCGAGTTT-AACTGGA is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 92674.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000252.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MTM1	NM_000252.3	MANE Select	c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA	p.Phe513_Leu522delinsAsnTrpIle	missense disruptive_inframe_deletion	N/A	NP_000243.1	Q13496-1
	MTM1	NM_001376908.1		c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA	p.Phe513_Leu522delinsAsnTrpIle	missense disruptive_inframe_deletion	N/A	NP_001363837.1	Q13496-1
	MTM1	NM_001376906.1		c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA	p.Phe513_Leu522delinsAsnTrpIle	missense disruptive_inframe_deletion	N/A	NP_001363835.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MTM1	ENST00000370396.7	TSL:1 MANE Select	c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA	p.Phe513_Leu522delinsAsnTrpIle	missense disruptive_inframe_deletion	N/A	ENSP00000359423.3	Q13496-1
	MTM1	ENST00000689314.1		c.1582_1609delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA	p.Phe528_Leu537delinsAsnTrpIle	missense disruptive_inframe_deletion	N/A	ENSP00000510607.1	A0A8I5KZ76
	MTM1	ENST00000866458.1		c.1582_1609delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA	p.Phe528_Leu537delinsAsnTrpIle	missense disruptive_inframe_deletion	N/A	ENSP00000536517.1

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)
1	-	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs398123271; hg19: chrX-149831975;