rs398123271

Variant names:

• chrX-150663502-TTCTATACTAAAGAAATCAATCGAGTTT-AACTGGA
• rs398123271
• NM_000252.3:c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_000252.3(MTM1):​c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA​(p.Phe513_Leu522delinsAsnTrpIle) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency: Genomes: not found (cov: 23)
• Consequence: MTM1 NM_000252.3 missense, disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 8.90

Genes affected

MTM1 (HGNC:7448): (myotubularin 1) This gene encodes a dual-specificity phosphatase that acts on both phosphotyrosine and phosphoserine. It is required for muscle cell differentiation and mutations in this gene have been identified as being responsible for X-linked myotubular myopathy. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000252.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-150663502-TTCTATACTAAAGAAATCAATCGAGTTT-AACTGGA is Pathogenic according to our data. Variant chrX-150663502-TTCTATACTAAAGAAATCAATCGAGTTT-AACTGGA is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 92674.We mark this variant Likely_pathogenic, oryginal submissions are: {Likely_pathogenic=1, Uncertain_significance=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MTM1	NM_000252.3	c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA	p.Phe513_Leu522delinsAsnTrpIle	missense_variant, disruptive_inframe_deletion		ENST00000370396.7	NP_000243.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MTM1	ENST00000370396.7	c.1537_1564delTTCTATACTAAAGAAATCAATCGAGTTTinsAACTGGA	p.Phe513_Leu522delinsAsnTrpIle	missense_variant, disruptive_inframe_deletion		1	NM_000252.3	ENSP00000359423.3

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not specified Pathogenic:1

Aug 11, 2017

Genetic Services Laboratory, University of Chicago

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Uncertain:1

Oct 15, 2013

Eurofins Ntd Llc (ga)

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs398123271; hg19: chrX-149831975;