chrX-154030612-GGGGCTCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTC-G

Position:

• chrX-154030612-GGGGCTCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTC-G

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BS2 BP5

This summary comes from the ClinGen Evidence Repository: The p.Glu394_Pro405del variant in MECP2 (NM_004992.4) is observed in at least 20 unaffected individuals (internal database - GeneDx; internal database - Invitae) (BS2). The p.Glu394_Pro405del variant is found in at least 2 patients with an alternate molecular basis of disease (internal database - GeneDx; internal database - Invitae) (BP5). The highest population minor allele frequency of the p.Glu394_Pro405del variant in MECP2 in gnomAD v4.1 is 0.00003691 in European (non-Finnish) population (not sufficient to meet BS1 criteria). In summary, the p.Glu394_Pro405del variant in MECP2 is classified as Likely Benign based on the ACMG/AMP criteria (BS2, BP5). LINK:https://erepo.genome.network/evrepo/ui/classification/CA10558461/MONDO:0010726/036

• Frequency:
  • Genomes: 𝑓 0.000028 (0 hom., 0 hem., cov: 16)
  • Exomes 𝑓: 0.000028 (0 hom. 15 hem.)
  • Failed GnomAD Quality Control
• Consequence: MECP2 NM_001110792.2 conservative_inframe_deletion
• Clinical Significance: Likely benign reviewed by expert panel U:4 B:1
• Conservation: PhyloP100: 4.77

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP5: For more information check the summary or visit ClinGen Evidence Repository.
• BS2: For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1216_1251delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu406_Pro417del	conservative_inframe_deletion	3/3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1180_1215delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu394_Pro405del	conservative_inframe_deletion	4/4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1216_1251delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu406_Pro417del	conservative_inframe_deletion	3/3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1180_1215delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu394_Pro405del	conservative_inframe_deletion	4/4	1	NM_004992.4	ENSP00000301948.6
MECP2	ENST00000407218	c.*552_*587delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC		3_prime_UTR_variant	4/4	5		ENSP00000384865.2
MECP2	ENST00000628176	c.*552_*587delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC		3_prime_UTR_variant	5/5	3		ENSP00000486978.1

Frequencies

GnomAD3 genomes AF: 0.0000276 AC: 3 AN: 108770 Hom.: 0 Cov.: 16 AF XY: 0.00 AC XY: 0 AN XY: 31042

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000577

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000169 AC: 3 AN: 177437 Hom.: 0 AF XY: 0.0000309 AC XY: 2 AN XY: 64817

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000378

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000283 AC: 31 AN: 1094532 Hom.: 0 AF XY: 0.0000415 AC XY: 15 AN XY: 361378

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000356

Gnomad4 OTH exome AF: 0.0000217

GnomAD4 genome AF: 0.0000276 AC: 3 AN: 108770 Hom.: 0 Cov.: 16 AF XY: 0.00 AC XY: 0 AN XY: 31042

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000577

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000151

ClinVar

Significance: Likely benign

Submissions summary: Uncertain:4 Benign:1

Revision: reviewed by expert panel

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Molecular Diagnostics Lab, Nemours Children's Health, Delaware

Jul 15, 2015

- -

Severe neonatal-onset encephalopathy with microcephaly Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Feb 22, 2024

This variant, c.1180_1215del, results in the deletion of 12 amino acid(s) of the MECP2 protein (p.Glu394_Pro405del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs782746707, gnomAD 0.003%). This variant has not been reported in the literature in individuals affected with MECP2-related conditions. ClinVar contains an entry for this variant (Variation ID: 393491). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Inborn genetic diseases Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

Jul 27, 2018

- -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Apr 01, 2021

In-frame deletion of 12 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Has not been previously published as pathogenic or benign to our knowledge -

Rett syndrome Benign:1

Likely benign, reviewed by expert panel

curation

ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel

Oct 30, 2024

The p.Glu394_Pro405del variant in MECP2 (NM_004992.4) is observed in at least 20 unaffected individuals (internal database - GeneDx; internal database - Invitae) (BS2). The p.Glu394_Pro405del variant is found in at least 2 patients with an alternate molecular basis of disease (internal database - GeneDx; internal database - Invitae) (BP5). The highest population minor allele frequency of the p.Glu394_Pro405del variant in MECP2 in gnomAD v4.1 is 0.00003691 in European (non-Finnish) population (not sufficient to meet BS1 criteria). In summary, the p.Glu394_Pro405del variant in MECP2 is classified as Likely Benign based on the ACMG/AMP criteria (BS2, BP5). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs782746707; hg19: chrX-153296063;