rs782746707

Variant names:

• chrX-154030612-GGGGCTCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTC-G
• rs782746707
• NM_001110792.2:c.1216_1251delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BS2 BP5

This summary comes from the ClinGen Evidence Repository: The p.Glu394_Pro405del variant in MECP2 (NM_004992.4) is observed in at least 20 unaffected individuals (internal database - GeneDx; internal database - Invitae) (BS2). The p.Glu394_Pro405del variant is found in at least 2 patients with an alternate molecular basis of disease (internal database - GeneDx; internal database - Invitae) (BP5). The highest population minor allele frequency of the p.Glu394_Pro405del variant in MECP2 in gnomAD v4.1 is 0.00003691 in European (non-Finnish) population (not sufficient to meet BS1 criteria). In summary, the p.Glu394_Pro405del variant in MECP2 is classified as Likely Benign based on the ACMG/AMP criteria (BS2, BP5). LINK:https://erepo.genome.network/evrepo/ui/classification/CA10558461/MONDO:0010726/036

• Frequency:
  • Genomes: 𝑓 0.000028 (0 hom., 0 hem., cov: 16)
  • Exomes 𝑓: 0.000028 (0 hom. 15 hem.)
  • Failed GnomAD Quality Control
• Consequence: MECP2 NM_001110792.2 conservative_inframe_deletion
• Clinical Significance: Likely benign reviewed by expert panel U:4 B:1
• Conservation: PhyloP100: 4.77
• Publications: 0 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, Orphanet, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for MECP2 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP5: For more information check the summary or visit ClinGen Evidence Repository.
• BS2: For more information check the summary or visit ClinGen Evidence Repository.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	NM_001110792.2	MANE Select	c.1216_1251delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu406_Pro417del	conservative_inframe_deletion	Exon 3 of 3	NP_001104262.1	A0A140VKC4
	MECP2	NM_004992.4	MANE Plus Clinical	c.1180_1215delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu394_Pro405del	conservative_inframe_deletion	Exon 4 of 4	NP_004983.1	D3YJ43
	MECP2	NM_001316337.2		c.901_936delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu301_Pro312del	conservative_inframe_deletion	Exon 5 of 5	NP_001303266.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	ENST00000453960.7	TSL:1 MANE Select	c.1216_1251delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu406_Pro417del	conservative_inframe_deletion	Exon 3 of 3	ENSP00000395535.2	P51608-2
	MECP2	ENST00000303391.11	TSL:1 MANE Plus Clinical	c.1180_1215delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu394_Pro405del	conservative_inframe_deletion	Exon 4 of 4	ENSP00000301948.6	P51608-1
	MECP2	ENST00000630151.3	TSL:5	c.1180_1215delGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCC	p.Glu394_Pro405del	conservative_inframe_deletion	Exon 4 of 4	ENSP00000486089.2	P51608-1

Frequencies

GnomAD3 genomes AF: 0.0000276 AC: 3 AN: 108770 Hom.: 0 Cov.: 16

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000577

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000169 AC: 3 AN: 177437 AF XY: 0.0000309

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000378

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000283 AC: 31 AN: 1094532 Hom.: 0 AF XY: 0.0000415 AC XY: 15 AN XY: 361378

African (AFR) AF: 0.00 AC: 0 AN: 26395

American (AMR) AF: 0.00 AC: 0 AN: 35206

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19385

East Asian (EAS) AF: 0.00 AC: 0 AN: 30204

South Asian (SAS) AF: 0.00 AC: 0 AN: 54133

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 37192

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3990

European-Non Finnish (NFE) AF: 0.0000356 AC: 30 AN: 841979

Other (OTH) AF: 0.0000217 AC: 1 AN: 46048

GnomAD4 genome AF: 0.0000276 AC: 3 AN: 108770 Hom.: 0 Cov.: 16 AF XY: 0.00 AC XY: 0 AN XY: 31042

African (AFR) AF: 0.00 AC: 0 AN: 29798

American (AMR) AF: 0.00 AC: 0 AN: 10231

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2599

East Asian (EAS) AF: 0.00 AC: 0 AN: 3489

South Asian (SAS) AF: 0.00 AC: 0 AN: 2417

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 5874

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 237

European-Non Finnish (NFE) AF: 0.0000577 AC: 3 AN: 52007

Other (OTH) AF: 0.00 AC: 0 AN: 1445

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000151

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
-	1	-	Inborn genetic diseases (1)
-	1	-	not provided (1)
-	1	-	not specified (1)
-	-	1	Rett syndrome (1)
-	1	-	Severe neonatal-onset encephalopathy with microcephaly (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=175/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs782746707; hg19: chrX-153296063;