chrX-154030619-AGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGG-A

Variant names:

• chrX-154030619-AGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGG-A
• rs1557135259
• NM_001110792.2:c.1191_1244delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_001110792.2(MECP2):​c.1191_1244delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC​(p.Leu398_Pro415del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000111 in 900,611 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. P397P) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 18)
  • Exomes 𝑓: 0.0000011 (0 hom. 0 hem.)
• Consequence: MECP2 NM_001110792.2 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 4.53
• Publications: 0 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 13 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 22 benign, 17 uncertain in NM_001110792.2
• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1191_1244delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Leu398_Pro415del	disruptive_inframe_deletion	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1155_1208delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Leu386_Pro403del	disruptive_inframe_deletion	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1191_1244delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Leu398_Pro415del	disruptive_inframe_deletion	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1155_1208delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC	p.Leu386_Pro403del	disruptive_inframe_deletion	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 18

GnomAD2 exomes AF: 0.00000570 AC: 1 AN: 175319 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.000136

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000111 AC: 1 AN: 900611 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 290651

African (AFR) AF: 0.00 AC: 0 AN: 21090

American (AMR) AF: 0.00 AC: 0 AN: 30525

Ashkenazi Jewish (ASJ) AF: 0.0000788 AC: 1 AN: 12696

East Asian (EAS) AF: 0.00 AC: 0 AN: 14981

South Asian (SAS) AF: 0.00 AC: 0 AN: 47183

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 20722

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2985

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 716876

Other (OTH) AF: 0.00 AC: 0 AN: 33553

GnomAD4 genome Cov.: 18

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rett syndrome Uncertain:1

Jun 30, 2015

Molecular Diagnostics Lab, Nemours Children's Health, Delaware

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Uncertain:1

Oct 03, 2024

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Identified in a patient with Rett syndrome (PMID: 23696494); In-frame deletion of 18 amino acid(s) in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 23696494) -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5
Mutation Taster		=1/199	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1557135259; hg19: chrX-153296070;