rs1557135259
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001110792.2(MECP2):c.1191_1244delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC(p.Leu398_Pro415del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000111 in 900,611 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001110792.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.1191_1244delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC | p.Leu398_Pro415del | disruptive_inframe_deletion | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
MECP2 | NM_004992.4 | c.1155_1208delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC | p.Leu386_Pro403del | disruptive_inframe_deletion | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000453960.7 | c.1191_1244delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC | p.Leu398_Pro415del | disruptive_inframe_deletion | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
MECP2 | ENST00000303391.11 | c.1155_1208delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCC | p.Leu386_Pro403del | disruptive_inframe_deletion | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes Cov.: 18
GnomAD3 exomes AF: 0.00000570 AC: 1AN: 175319Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 63691
GnomAD4 exome AF: 0.00000111 AC: 1AN: 900611Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 290651
GnomAD4 genome Cov.: 18
ClinVar
Submissions by phenotype
Rett syndrome Uncertain:1
- -
not provided Uncertain:1
Identified in a patient with Rett syndrome (PMID: 23696494); In-frame deletion of 18 amino acid(s) in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 23696494) -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at