chrX-154030630-TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-T
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong
The NM_001110792.2(MECP2):c.1193_1233delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC(p.Leu398fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Genomes: not found (cov: 18)
Consequence
MECP2
NM_001110792.2 frameshift
NM_001110792.2 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 3.50
Genes affected
MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.203 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
PP5
Variant X-154030630-TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-T is Pathogenic according to our data. Variant chrX-154030630-TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 143369.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-154030630-TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-T is described in Lovd as [Pathogenic]. Variant chrX-154030630-TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-T is described in Lovd as [Pathogenic].
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.1193_1233delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | p.Leu398fs | frameshift_variant | 3/3 | ENST00000453960.7 | NP_001104262.1 | |
MECP2 | NM_004992.4 | c.1157_1197delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | p.Leu386fs | frameshift_variant | 4/4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000453960.7 | c.1193_1233delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | p.Leu398fs | frameshift_variant | 3/3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
MECP2 | ENST00000303391.11 | c.1157_1197delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | p.Leu386fs | frameshift_variant | 4/4 | 1 | NM_004992.4 | ENSP00000301948.6 | ||
MECP2 | ENST00000407218 | c.*529_*569delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | 3_prime_UTR_variant | 4/4 | 5 | ENSP00000384865.2 | ||||
MECP2 | ENST00000628176 | c.*529_*569delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | 3_prime_UTR_variant | 5/5 | 3 | ENSP00000486978.1 |
Frequencies
GnomAD3 genomes Cov.: 18
GnomAD3 genomes
Cov.:
18
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 18
GnomAD4 genome
Cov.:
18
ClinVar
Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:23Other:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Rett syndrome Pathogenic:13
Pathogenic, criteria provided, single submitter | clinical testing | Mendelics | May 28, 2019 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Baylor Genetics | Aug 15, 2023 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Genetic Services Laboratory, University of Chicago | Feb 08, 2013 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Medical Molecular Genetics Department, National Research Center | Nov 02, 2016 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Neuberg Centre For Genomic Medicine, NCGM | May 20, 2023 | The frameshift variant c.1193_1233del (p.Leu398HisfsTer5) in the MECP2 gene has been reported previously in individuals affected with Rett Syndrome (Chapleau et al., 2013; Ravn et al., 2011). This variant is absent in the gnomAD Exomes. It is submitted to ClinVar as Likely Pathogenic/ Pathogenic (multiple submitters). This variant is predicted to cause a loss of normal protein function through protein truncation. Loss of function variants have been previously reported to be disease-causing. For these reasons, this variant has been classified as Pathogenic. - |
Pathogenic, criteria provided, single submitter | clinical testing | Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics | Nov 14, 2024 | A heterozygous 41 base pair deletion in exon 3 of the MECP2 gene that results in a frameshift and premature truncation of the protein 5 amino acids downstream to codon 398 (p.Leu398Hisfs*5; ENST00000453960.7) was detected. This variant has not been reported in the 1000 genomes and gnomAD databases. The in silico prediction of the variant is damaging MutationTaster2. This variant has been previously reported in the ClinVar database as pathogenic (SCV003804920.1). In summary, the variant meets our criteria to be classified as pathogenic. - |
Pathogenic, criteria provided, single submitter | curation | Centre for Population Genomics, CPG | Mar 22, 2024 | This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). (ClinVar Variation ID: 143369 PMID:11269512 , PMID:23810759 , PMID:23696494 , PMID:21878110 , PMID:20031356 ). This variant is absent from gnomAD (PM2_Supporting). - |
Pathogenic, criteria provided, single submitter | research | HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology | Mar 17, 2016 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Molecular Diagnostics Lab, Nemours Children's Health, Delaware | Jun 30, 2015 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Women's Health and Genetics/Laboratory Corporation of America, LabCorp | May 26, 2016 | Variant summary: The MECP2 c.1157_1197del41 (p.Leu386Hisfs) is a large deletion, resulting in a reading frame shift. One in silico tool predicts a damaging outcome for this variant. This variant is absent in 1380 control chromosomes, but has been identified in numerous classic and atypical Rett Syndrome patients in the literature. In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic. Taken together, this variant is classified as pathogenic. - |
Pathogenic, no assertion criteria provided | curation | RettBASE | Dec 05, 2013 | - - |
Likely pathogenic, criteria provided, single submitter | clinical testing | Institute of Human Genetics, Clinical Exome/Genome Diagnostics Group, University Hospital Bonn | Apr 22, 2022 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Undiagnosed Diseases Network, NIH | Aug 31, 2017 | 41 base pair deletion resulting in a frameshift, which is predicted to result in loss of function in the MECP2 gene, where loss of function is a known mechanism of Rett syndrome. This variant has been observed in multiple, unrelated, affected individuals with Rett syndrome (PMID: 12673788) - |
not provided Pathogenic:4Other:1
not provided, flagged submission | literature only | RettBASE | - | - - |
Pathogenic, criteria provided, single submitter | clinical testing | CeGaT Center for Human Genetics Tuebingen | May 01, 2021 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories | May 16, 2017 | The MECP2 c.1157_1197del, p.Leu386fs variant (rs267608327) is a recurrent deletion found in individuals diagnosed with RETT syndrome (Bienvenu 2002, Chae 2002, Cheadle 2000, Hoffbuhr 2001, Philippe 2006, Ravn 2011, Yaron 2002, Zahorakova 2007), and has associated with both classical disease and a milder form known as the preserved speech variant (Conforti 2002, De Bona 2008, Ravn 2011). It is listed as pathogenic in ClinVar (Variation ID: 143369), but not observed in the general population databases (1000 Genomes Project, Exome Variant Server, Genome Aggregation Database). The variant introduces a frameshift, and is predicted to result in a truncated protein. Based on the above information, the variant is classified as pathogenic. References: Bienvenu T et al. Spectrum of MECP2 mutations in Rett syndrome. Genet Test. 2002; 6(1):1-6. Chae J et al. Mutation analysis of MECP2 and clinical characterization in Korean patients with Rett syndrome. J Child Neurol. 2002; 17(1):33-6. Cheadle J et al. Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of disease severity with mutation type and location. Hum Mol Genet. 2000; 9(7):1119-29. Conforti F et al. Mutation analysis of the MECP2 gene in patients with Rett syndrome. Am J Med Genet A. 2003; 117A(2):184-7. De Bona C et al. Preserved speech variant is allelic of classic Rett syndrome. Eur J Hum Genet. 2000; 8(5):325-30. Hoffbuhr K et al. MeCP2 mutations in children with and without the phenotype of Rett syndrome. Neurology. 2001; 56(11):1486-95. Philippe C et al. Spectrum and distribution of MECP2 mutations in 424 Rett syndrome patients: a molecular update. Eur J Med Genet. 2006; 49(1):9-18. Ravn K et al. Two new Rett syndrome families and review of the literature: expanding the knowledge of MECP2 frameshift mutations. Orphanet J Rare Dis. 2011; 6:58. Yaron Y et al. MECP2 mutations in Israel: implications for molecular analysis, genetic counseling, and prenatal diagnosis in Rett syndrome. Hum Mutat. 2002; 20(4):323-4. Zahorakova D et al. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms. J Hum Genet. 2007; 52(4):342-8. - |
Pathogenic, criteria provided, single submitter | clinical testing | Eurofins Ntd Llc (ga) | Jan 12, 2018 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | GeneDx | Mar 24, 2022 | Frameshift variant predicted to result in protein truncation in a gene for which loss-of-function is a known mechanism of disease; Not observed in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 26984561, 16473305, 10767337, 11746022, 17142618, 21878110, 23810759, 17387578, 11402105, 21160487, 33168794, 31943886, 34876818, 34782041, 32105570, 32631363) - |
See cases Pathogenic:2
Pathogenic, criteria provided, single submitter | clinical testing | Institute of Human Genetics, University Hospital Muenster | Nov 11, 2022 | ACMG categories: PVS1,PM1,PM2,PP5 - |
Pathogenic, criteria provided, single submitter | clinical testing | Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein | Mar 24, 2021 | ACMG classification criteria: PVS1, PS4, PM2, PM6 - |
Autism, susceptibility to, X-linked 3 Pathogenic:1Other:1
Pathogenic, flagged submission | curation | RettBASE | Dec 05, 2013 | - - |
risk factor, no assertion criteria provided | literature only | OMIM | Mar 01, 2003 | - - |
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Oct 03, 2023 | This sequence change creates a premature translational stop signal (p.Leu386Hisfs*5) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Rett syndrome (PMID: 10767337, 11746022, 11913567, 12325033, 16473305, 17089071, 17142618, 17387578, 19914908, 21878110). In at least one individual the variant was observed to be de novo. It has also been observed to segregate with disease in related individuals. This variant is also known as c.1157_1197del41 and c.1157del41. ClinVar contains an entry for this variant (Variation ID: 143369). For these reasons, this variant has been classified as Pathogenic. - |
Rett syndrome, zappella variant Pathogenic:1
Pathogenic, no assertion criteria provided | literature only | OMIM | Mar 01, 2003 | - - |
X-linked intellectual disability-psychosis-macroorchidism syndrome Pathogenic:1
Pathogenic, flagged submission | curation | RettBASE | Dec 05, 2013 | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at