rs267608327
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong
The NM_001110792.2(MECP2):c.1193_1233delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC(p.Leu398HisfsTer5) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MECP2 | NM_001110792.2 | c.1193_1233delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | p.Leu398HisfsTer5 | frameshift_variant | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
| MECP2 | NM_004992.4 | c.1157_1197delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | p.Leu386HisfsTer5 | frameshift_variant | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MECP2 | ENST00000453960.7 | c.1193_1233delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | p.Leu398HisfsTer5 | frameshift_variant | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
| MECP2 | ENST00000303391.11 | c.1157_1197delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC | p.Leu386HisfsTer5 | frameshift_variant | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes
GnomAD4 genome
ClinVar
Submissions by phenotype
Rett syndrome Pathogenic:14
- -
- -
- -
- -
- -
- -
Criteria applied: PVS1,PS4,PM2,PS2_SUP -
- -
41 base pair deletion resulting in a frameshift, which is predicted to result in loss of function in the MECP2 gene, where loss of function is a known mechanism of Rett syndrome. This variant has been observed in multiple, unrelated, affected individuals with Rett syndrome (PMID: 12673788) -
A heterozygous 41 base pair deletion in exon 3 of the MECP2 gene that results in a frameshift and premature truncation of the protein 5 amino acids downstream to codon 398 (p.Leu398Hisfs*5; ENST00000453960.7) was detected. This variant has not been reported in the 1000 genomes and gnomAD databases. The in silico prediction of the variant is damaging MutationTaster2. This variant has been previously reported in the ClinVar database as pathogenic (SCV003804920.1). In summary, the variant meets our criteria to be classified as pathogenic. -
- -
The frameshift variant c.1193_1233del (p.Leu398HisfsTer5) in the MECP2 gene has been reported previously in individuals affected with Rett Syndrome (Chapleau et al., 2013; Ravn et al., 2011). This variant is absent in the gnomAD Exomes. It is submitted to ClinVar as Likely Pathogenic/ Pathogenic (multiple submitters). This variant is predicted to cause a loss of normal protein function through protein truncation. Loss of function variants have been previously reported to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). (ClinVar Variation ID: 143369 PMID:11269512 , PMID:23810759 , PMID:23696494 , PMID:21878110 , PMID:20031356 ). This variant is absent from gnomAD (PM2_Supporting). -
Variant summary: The MECP2 c.1157_1197del41 (p.Leu386Hisfs) is a large deletion, resulting in a reading frame shift. One in silico tool predicts a damaging outcome for this variant. This variant is absent in 1380 control chromosomes, but has been identified in numerous classic and atypical Rett Syndrome patients in the literature. In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic. Taken together, this variant is classified as pathogenic. -
not provided Pathogenic:5Other:1
The MECP2 c.1157_1197del (p.Leu386Hisfs*5) variant alters the translational reading frame of the MECP2 mRNA and causes the premature termination of MECP2 protein synthesis. This variant is not expected to cause loss of protein expression through nonsense-mediated decay. However, it disrupts a substantial portion of the protein, and therefore, is expected to disrupt function. This variant has been reported in the published literature in multiple individuals affected with Rett Syndrome (PMID: 10767337 (2000), 11241840 (2011), 15526954 (2004), 16473305 (2006), 23696494 (2013), 23810759 (2013)). This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Based on the available information, this variant is classified as pathogenic. -
- -
- -
- -
The MECP2 c.1157_1197del, p.Leu386fs variant (rs267608327) is a recurrent deletion found in individuals diagnosed with RETT syndrome (Bienvenu 2002, Chae 2002, Cheadle 2000, Hoffbuhr 2001, Philippe 2006, Ravn 2011, Yaron 2002, Zahorakova 2007), and has associated with both classical disease and a milder form known as the preserved speech variant (Conforti 2002, De Bona 2008, Ravn 2011). It is listed as pathogenic in ClinVar (Variation ID: 143369), but not observed in the general population databases (1000 Genomes Project, Exome Variant Server, Genome Aggregation Database). The variant introduces a frameshift, and is predicted to result in a truncated protein. Based on the above information, the variant is classified as pathogenic. References: Bienvenu T et al. Spectrum of MECP2 mutations in Rett syndrome. Genet Test. 2002; 6(1):1-6. Chae J et al. Mutation analysis of MECP2 and clinical characterization in Korean patients with Rett syndrome. J Child Neurol. 2002; 17(1):33-6. Cheadle J et al. Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of disease severity with mutation type and location. Hum Mol Genet. 2000; 9(7):1119-29. Conforti F et al. Mutation analysis of the MECP2 gene in patients with Rett syndrome. Am J Med Genet A. 2003; 117A(2):184-7. De Bona C et al. Preserved speech variant is allelic of classic Rett syndrome. Eur J Hum Genet. 2000; 8(5):325-30. Hoffbuhr K et al. MeCP2 mutations in children with and without the phenotype of Rett syndrome. Neurology. 2001; 56(11):1486-95. Philippe C et al. Spectrum and distribution of MECP2 mutations in 424 Rett syndrome patients: a molecular update. Eur J Med Genet. 2006; 49(1):9-18. Ravn K et al. Two new Rett syndrome families and review of the literature: expanding the knowledge of MECP2 frameshift mutations. Orphanet J Rare Dis. 2011; 6:58. Yaron Y et al. MECP2 mutations in Israel: implications for molecular analysis, genetic counseling, and prenatal diagnosis in Rett syndrome. Hum Mutat. 2002; 20(4):323-4. Zahorakova D et al. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms. J Hum Genet. 2007; 52(4):342-8. -
Frameshift variant predicted to result in protein truncation in a gene for which loss-of-function is a known mechanism of disease; Not observed in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 26984561, 16473305, 10767337, 11746022, 17142618, 21878110, 23810759, 17387578, 11402105, 21160487, 33168794, 31943886, 34876818, 34782041, 32105570, 32631363) -
See cases Pathogenic:2
ACMG classification criteria: PVS1, PS4, PM2, PM6 -
ACMG categories: PVS1,PM1,PM2,PP5 -
Autism, susceptibility to, X-linked 3 Pathogenic:1Other:1
- -
- -
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
This sequence change creates a premature translational stop signal (p.Leu386Hisfs*5) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Rett syndrome (PMID: 10767337, 11746022, 11913567, 12325033, 16473305, 17089071, 17142618, 17387578, 19914908, 21878110). In at least one individual the variant was observed to be de novo. It has also been observed to segregate with disease in related individuals. This variant is also known as c.1157_1197del41 and c.1157del41. ClinVar contains an entry for this variant (Variation ID: 143369). For these reasons, this variant has been classified as Pathogenic. -
Rett syndrome, zappella variant Pathogenic:1
- -
X-linked intellectual disability-psychosis-macroorchidism syndrome Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at