chrX-154030783-TCTCCTTGCTTTTCCGCCCAGGGCTCTTACAGGTCTTCAGTCCTTTCCCGCTCTTCTCACCGAGGGTGGACACCAGCAGGGGCTTCACCACTTCCTTGACCTCGATGCTGACCGTCTCCCGGGTCTTGCGCTTCTTGATGGGGAGTACGGTCTCCTGCACAGATCGGATAGAAGA-T
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PM2PM4PP5_Very_Strong
The NM_001110792.2(MECP2):c.907_1080del(p.Ser303_Glu360del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★★).
Frequency
Consequence
NM_001110792.2 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.907_1080del | p.Ser303_Glu360del | conservative_inframe_deletion | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
MECP2 | NM_004992.4 | c.871_1044del | p.Ser291_Glu348del | conservative_inframe_deletion | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000453960.7 | c.907_1080del | p.Ser303_Glu360del | conservative_inframe_deletion | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
MECP2 | ENST00000303391.11 | c.871_1044del | p.Ser291_Glu348del | conservative_inframe_deletion | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Submissions by phenotype
Rett syndrome Pathogenic:3
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as likely pathogenic. At least the following criteria are met: Occurs in the well-characterized Transcriptional repression domain (TRD) of MECP2 (PM1). Protein length changes due to in-frame deletions/insertions in a non-repeat region (PM4). This variant is absent from gnomAD (PM2_Supporting). Has been observed in at least 2 individuals with phenotypes consistent with MECP2-related disease (PS4_Supporting).(ClinVar Variation ID: 189732, PMID 22277191) -
- -
The p.Ile293_Ser350del variant in MECP2 (NM_004992.3) causes an in-frame deletion of 58 amino acids in a non-repeat region of MECP2, which results in a deletion of greater than 10% of the total protein length (PM4_strong). The p.Ile293_Ser350del variant occurs in the well-characterized transcription repression functional domain of the MECP2 gene (PM1). The p.Ile293_Ser350del variant has been observed in at least 2 individuals with Rett syndrome or atypical Rett syndrome (PMID 22277191, internal database - Invitae) (PS4_supporting). In summary, the p.Ile293_Ser350del variant in MECP2 is classified as Likely Pathogenic for Rett syndrome based on the ACMG/AMP criteria (PM4_strong, PM1, PS4_supporting). -
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
This variant has been observed in individual(s) with atypical Rett syndrome (PMID: 22277191). For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro302His) have been determined to be pathogenic (PMID: 10944854, 15737703, 16225173). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 189732). This variant is not present in population databases (gnomAD no frequency). This variant, c.871_1044del, results in the deletion of 58 amino acid(s) of the MECP2 protein (p.Ile293_Ser350del), but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at