chrX-154030783-TCTCCTTGCTTTTCCGCCCAGGGCTCTTACAGGTCTTCAGTCCTTTCCCGCTCTTCTCACCGAGGGTGGACACCAGCAGGGGCTTCACCACTTCCTTGACCTCGATGCTGACCGTCTCCCGGGTCTTGCGCTTCTTGATGGGGAGTACGGTCTCCTGCACAGATCGGATAGAAGA-T
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PM1PM4PP5_Very_Strong
The NM_001110792.2(MECP2):c.907_1080del(p.Ser303_Glu360del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★★).
Frequency
Consequence
NM_001110792.2 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.907_1080del | p.Ser303_Glu360del | conservative_inframe_deletion | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
MECP2 | NM_004992.4 | c.871_1044del | p.Ser291_Glu348del | conservative_inframe_deletion | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000453960.7 | c.907_1080del | p.Ser303_Glu360del | conservative_inframe_deletion | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
MECP2 | ENST00000303391.11 | c.871_1044del | p.Ser291_Glu348del | conservative_inframe_deletion | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Submissions by phenotype
Rett syndrome Pathogenic:3
The p.Ile293_Ser350del variant in MECP2 (NM_004992.3) causes an in-frame deletion of 58 amino acids in a non-repeat region of MECP2, which results in a deletion of greater than 10% of the total protein length (PM4_strong). The p.Ile293_Ser350del variant occurs in the well-characterized transcription repression functional domain of the MECP2 gene (PM1). The p.Ile293_Ser350del variant has been observed in at least 2 individuals with Rett syndrome or atypical Rett syndrome (PMID 22277191, internal database - Invitae) (PS4_supporting). In summary, the p.Ile293_Ser350del variant in MECP2 is classified as Likely Pathogenic for Rett syndrome based on the ACMG/AMP criteria (PM4_strong, PM1, PS4_supporting). -
- -
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as likely pathogenic. At least the following criteria are met: Occurs in the well-characterized Transcriptional repression domain (TRD) of MECP2 (PM1). Protein length changes due to in-frame deletions/insertions in a non-repeat region (PM4). This variant is absent from gnomAD (PM2_Supporting). Has been observed in at least 2 individuals with phenotypes consistent with MECP2-related disease (PS4_Supporting).(ClinVar Variation ID: 189732, PMID 22277191) -
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
This variant has been observed in individual(s) with atypical Rett syndrome (PMID: 22277191). For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro302His) have been determined to be pathogenic (PMID: 10944854, 15737703, 16225173). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 189732). This variant is not present in population databases (gnomAD no frequency). This variant, c.871_1044del, results in the deletion of 58 amino acid(s) of the MECP2 protein (p.Ile293_Ser350del), but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at