rs1557136013

Variant names:

• chrX-154030783-TCTCCTTGCTTTTCCGCCCAGGGCTCTTACAGGTCTTCAGTCCTTTCCCGCTCTTCTCACCGAGGGTGGACACCAGCAGGGGCTTCACCACTTCCTTGACCTCGATGCTGACCGTCTCCCGGGTCTTGCGCTTCTTGATGGGGAGTACGGTCTCCTGCACAGATCGGATAGAAGA-T
• rs1557136013
• NM_001110792.2:c.907_1080del

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PM1 PM4 PP5_Very_Strong

The NM_001110792.2(MECP2):​c.907_1080del​(p.Ser303_Glu360del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: MECP2 NM_001110792.2 conservative_inframe_deletion
• Clinical Significance: Likely pathogenic reviewed by expert panel P:4
• Conservation: PhyloP100: 4.80
• Publications: 0 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 4 benign, 10 uncertain in NM_001110792.2
• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.
• PP5: Variant X-154030783-TCTCCTTGCTTTTCCGCCCAGGGCTCTTACAGGTCTTCAGTCCTTTCCCGCTCTTCTCACCGAGGGTGGACACCAGCAGGGGCTTCACCACTTCCTTGACCTCGATGCTGACCGTCTCCCGGGTCTTGCGCTTCTTGATGGGGAGTACGGTCTCCTGCACAGATCGGATAGAAGA-T is Pathogenic according to our data. Variant chrX-154030783-TCTCCTTGCTTTTCCGCCCAGGGCTCTTACAGGTCTTCAGTCCTTTCCCGCTCTTCTCACCGAGGGTGGACACCAGCAGGGGCTTCACCACTTCCTTGACCTCGATGCTGACCGTCTCCCGGGTCTTGCGCTTCTTGATGGGGAGTACGGTCTCCTGCACAGATCGGATAGAAGA-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 189732.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.907_1080del	p.Ser303_Glu360del	conservative_inframe_deletion	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.871_1044del	p.Ser291_Glu348del	conservative_inframe_deletion	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.907_1080del	p.Ser303_Glu360del	conservative_inframe_deletion	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.871_1044del	p.Ser291_Glu348del	conservative_inframe_deletion	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:4

Revision: reviewed by expert panel

Submissions by phenotype

Rett syndrome Pathogenic:3

Oct 13, 2022

ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel

Significance: Likely pathogenic

Review Status: reviewed by expert panel

Collection Method: curation

The p.Ile293_Ser350del variant in MECP2 (NM_004992.3) causes an in-frame deletion of 58 amino acids in a non-repeat region of MECP2, which results in a deletion of greater than 10% of the total protein length (PM4_strong). The p.Ile293_Ser350del variant occurs in the well-characterized transcription repression functional domain of the MECP2 gene (PM1). The p.Ile293_Ser350del variant has been observed in at least 2 individuals with Rett syndrome or atypical Rett syndrome (PMID 22277191, internal database - Invitae) (PS4_supporting). In summary, the p.Ile293_Ser350del variant in MECP2 is classified as Likely Pathogenic for Rett syndrome based on the ACMG/AMP criteria (PM4_strong, PM1, PS4_supporting). -

Sep 27, 2012

RettBASE

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Mar 25, 2024

Centre for Population Genomics, CPG

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as likely pathogenic. At least the following criteria are met: Occurs in the well-characterized Transcriptional repression domain (TRD) of MECP2 (PM1). Protein length changes due to in-frame deletions/insertions in a non-repeat region (PM4). This variant is absent from gnomAD (PM2_Supporting). Has been observed in at least 2 individuals with phenotypes consistent with MECP2-related disease (PS4_Supporting).(ClinVar Variation ID: 189732, PMID 22277191) -

Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1

Jul 14, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has been observed in individual(s) with atypical Rett syndrome (PMID: 22277191). For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro302His) have been determined to be pathogenic (PMID: 10944854, 15737703, 16225173). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 189732). This variant is not present in population databases (gnomAD no frequency). This variant, c.871_1044del, results in the deletion of 58 amino acid(s) of the MECP2 protein (p.Ile293_Ser350del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=7/193	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1557136013; hg19: chrX-153296234;