chrX-154379725-GAGTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCC-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000117.3(EMD):c.121_155delTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCCAG(p.Tyr41LeufsTer8) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000117.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- X-linked Emery-Dreifuss muscular dystrophyInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- heart conduction diseaseInheritance: XL Classification: STRONG Submitted by: Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 25
GnomAD4 genome Cov.: 25
ClinVar
Submissions by phenotype
not provided Pathogenic:1
- -
X-linked Emery-Dreifuss muscular dystrophy Pathogenic:1
This sequence change creates a premature translational stop signal (p.Tyr41Leufs*8) in the EMD gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in EMD are known to be pathogenic (PMID: 24365856). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with EMD-related conditions. ClinVar contains an entry for this variant (Variation ID: 433167). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at