rs1557182286

Variant names:

• chrX-154379725-GAGTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCC-G
• rs1557182286
• NM_000117.3:c.121_155delTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCCAG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000117.3(EMD):​c.121_155delTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCCAG​(p.Tyr41LeufsTer8) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 25)
• Consequence: EMD NM_000117.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 3.35

Genes affected

EMD (HGNC:3331): (emerin) Emerin is a serine-rich nuclear membrane protein and a member of the nuclear lamina-associated protein family. It mediates membrane anchorage to the cytoskeleton. Dreifuss-Emery muscular dystrophy is an X-linked inherited degenerative myopathy resulting from mutation in the emerin gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-154379725-GAGTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCC-G is Pathogenic according to our data. Variant chrX-154379725-GAGTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 433167.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EMD	NM_000117.3	c.121_155delTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCCAG	p.Tyr41LeufsTer8	frameshift_variant	Exon 2 of 6	ENST00000369842.9	NP_000108.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EMD	ENST00000369842.9	c.121_155delTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCCAG	p.Tyr41LeufsTer8	frameshift_variant	Exon 2 of 6	1	NM_000117.3	ENSP00000358857.4

Frequencies

GnomAD3 genomes Cov.: 25

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 25

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1

Jul 13, 2016

Molecular Diagnostics Lab, Nemours Children's Health, Delaware

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

X-linked Emery-Dreifuss muscular dystrophy Pathogenic:1

Nov 27, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Tyr41Leufs*8) in the EMD gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in EMD are known to be pathogenic (PMID: 24365856). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with EMD-related conditions. ClinVar contains an entry for this variant (Variation ID: 433167). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1557182286; hg19: chrX-153608085;