chrX-25013543-G-GCGGCCGCGGCTGCCGCGGCGGCCC

Variant names:

• chrX-25013543-G-GCGGCCGCGGCTGCCGCGGCGGCCC
• rs387906493
• NM_139058.3:c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG

GermlineCancer (beta)

Variant summary

Our verdict is Likely pathogenic.

+7 Likely Pathogenic

-7

-6

-1

0

+5

+6

+9

+10

BenignB

Likely BenignLB

UncertainVUS

Likely PathogenicLP

PathogenicP

The variant received 7 classification points (ACMG Germline Pathogenicity v2019). PS3PM4PP5

The NM_139058.3(ARX):c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG (p.Gly143_Ala150dup) variant causes a conservative inframe insertion change. The variant results in an in-frame change. Note: allele frequency estimates from gnomAD may be inaccurate for this variant type (MNP or indel longer than 3 bp) due to technology limitations. The variant allele was found at a cumulative frequency of 0.0000767 (AC=8) in the gnomAD database across 104,289 control chromosomes (no homozygotes or hemizygotes observed). The grpmax filtering allele frequency (95% CI) is 0.000111. Note: a gnomAD entry for this variant shows a statistical allele-bias signature, consistent with mosaic/somatic contamination (e.g. age-related clonal hematopoiesis) rather than true inherited population frequency — this frequency should not be read as evidence of a common, benign germline variant. Variant has been reported in ClinVar as Pathogenic/Likely Pathogenic (no review stars). ClinVar reports functional evidence for this variant: "SCV000829094: Studies have shown that this variant alters ARX gene expression (PMID:17331656).".

• Frequency:
  • Genomes: 𝑓 0.000077 (0 hom., 0 hem., cov: 21)
  • Exomes 𝑓: 0.000010 (0 hom. 2 hem.)
• Consequence: ARX NM_139058.3 conservative_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:6 U:1
• Conservation: PhyloP100: 0.378
• Publications: 20 publications found

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ARX Gene-Disease associations (from GenCC):

• genetic developmental and epileptic encephalopathy

  Inheritance: XL, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P, ClinGen
• developmental and epileptic encephalopathy, 1

  Inheritance: XL Classification: STRONG Submitted by: PanelApp Australia
• neurodevelopmental disorder

  Inheritance: XL Classification: STRONG Submitted by: PanelApp Australia
• X-linked lissencephaly with abnormal genitalia

  Inheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
• intellectual disability, X-linked, with or without seizures, ARX-related

  Inheritance: XL Classification: MODERATE Submitted by: Ambry Genetics
• corpus callosum agenesis-abnormal genitalia syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• infantile epileptic-dyskinetic encephalopathy

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• Partington syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked spasticity-intellectual disability-epilepsy syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

Classification according to ACMG Germline Pathogenicity v2019

Classification was made for transcript:

Our verdict: Likely_pathogenic. The variant received 7 points.

Apply	Criterion Code & Title / Strength	Strength	Rationale / Clinical Context
	PS3Functional studies show damaging effect		Well-established functional study supports damaging effect (PS3); SCV000829094: Studies have shown that this variant alters ARX gene expression (PMID: 17331656).
	PM4Protein length change in non-repeat region		In-frame indel in non-repetitive region — protein length change (PM4); In-frame indel in non-repetitive region — protein length change (8 AA).
	PP5Reputable source reports pathogenic		ClinVar 0-star pathogenic — supporting (PP5); ClinVar germline classification: Pathogenic/Likely Pathogenic, 0 star(s).

Variant Effect in Transcripts

Automated classification analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated classification assignments.

RefSeq Transcripts

Sel.	Gene / Transcript	Tags	HGVSc / HGVSp	Effect	Exon rank	Protein / UniProt
	ARX NM_139058.3	MANE Select	c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG p.Gly143_Ala150dup	conservative_inframe_insertion	Exon 2 of 5	Prot: NP_620689.1 UniProt:

ARX NM_139058.3

MANE Select

HGVSc / HGVSpc.428_451dupGGGCCGCCGCGGCAGCCGCGGCCGp.Gly143_Ala150dup

Exon rankExon 2 of 5

conservative_inframe_insertion

Prot: NP_620689.1UniProt: Q96QS3

Ensembl Transcripts

Sel.	Gene / Transcript	Tags	HGVSc / HGVSp	Effect	Exon rank	Protein / UniProt
	ARX ENST00000379044.5	TSL:1MANE Select	c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG p.Gly143_Ala150dup	conservative_inframe_insertion	Exon 2 of 5	Prot: ENSP00000368332.4 UniProt:

ARX ENST00000379044.5

TSL:1MANE Select

HGVSc / HGVSpc.428_451dupGGGCCGCCGCGGCAGCCGCGGCCGp.Gly143_Ala150dup

Exon rankExon 2 of 5

conservative_inframe_insertion

Prot: ENSP00000368332.4UniProt: Q96QS3

Frequencies

Allele frequencies (AF), counts (AC/AN), homozygotes and coverage

Common (AF > 0.05 / Hom > 5)

Rare (AF ≤ 0.0001 / Hom ≤ 1)

Source / population	AF	AC	Hom	AN	Coverage
Global population databases 4 sources Large-scale international reference populations
GnomAD3 genomes	AF: 0.0000767	AC:8	Hom:0	AN:104289	Cov:21
GnomAD4 exome Warning	AF: 0.0000101	AC:7	Hom:0	AN:690637	Cov:30
GnomAD4 genome	AF: 0.0000767	AC:8	Hom:0	AN:104289	Cov:21
ALFA (dbGaP/dbSNP Allele Frequency Aggregator)	AF: 0.00	AC:0	Hom:1	AN:19648	Cov:
Local & regional cohorts 1 source Population-specific and national genomic databases
ToMMo 61KJPN (+60KJPN MNV)	AF: 0.00	AC:0	Hom:0	AN:89408	Cov:

Showing 5 sources

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
2	-	-	Intellectual disability, X-linked, with or without seizures, ARX-related (2)
1	1	-	not provided (2)
1	-	-	Developmental and epileptic encephalopathy, 1 (1)
1	-	-	Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 (1)
1	-	-	Partington syndrome (1)

Computational Scores

Algorithm	Calibrated pred.	Score	Prediction
PhyloP100	Benign	0.38

Showing 1 of 1 scores

Splicing Scores

No splicing scores have been computed for this variant.

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

MaveDB functional evidence

MaveDB is a public repository of laboratory assays that test the effect of thousands of variants at once — treat this as supporting research data and interpret it with great caution; it is not a clinical classification.

No MaveDB functional evidence found for this variant.

Other links and lift over

dbSNP: rs387906493;

hg19: chrX-25031660;

ACMG debug oncogenicity

ACGS debug oncogenicity

ACMG debug germline

Submit to ClinVar