chrX-31177963-TAACGGGACTGCAAAACAAAAAATGAGGTGGTGAAGGAGACACACGCAAACTCAGCCGCAAAAAAATTTACTGAAAGGTCAAAATAAATAAAATCCAGCCAATTAAGTATGAACCATGGAAAGCAATAGCCAAACCAAGGTGTAAAGTGAATTAAAAGAAAAACACACAGTTGTGTGACTGCC-T
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_004006.3(DMD):c.10224-175_10230del(p.Pro3409fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T3408T) has been classified as Uncertain significance. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_004006.3 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
- dilated cardiomyopathy 3BInheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
- Duchenne and Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- Duchenne muscular dystrophyInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Orphanet
- progressive muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- symptomatic form of muscular dystrophy of Duchenne and Becker in female carriersInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004006.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | NM_004006.3 | MANE Select | c.10224-175_10230del | p.Pro3409fs | frameshift splice_acceptor splice_region intron | Exon 71 of 79 | NP_003997.2 | ||
| DMD | NM_004009.3 | c.10212-175_10218del | p.Pro3405fs | frameshift splice_acceptor splice_region intron | Exon 71 of 79 | NP_004000.1 | |||
| DMD | NM_000109.4 | c.10200-175_10206del | p.Pro3401fs | frameshift splice_acceptor splice_region intron | Exon 71 of 79 | NP_000100.3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | ENST00000357033.9 | TSL:1 MANE Select | c.10224-175_10230del | p.Pro3409fs | frameshift splice_acceptor splice_region intron | Exon 71 of 79 | ENSP00000354923.3 | ||
| DMD | ENST00000378723.7 | TSL:1 | c.1020-175_1026del | p.Pro341fs | frameshift splice_acceptor splice_region intron | Exon 10 of 17 | ENSP00000367997.3 | ||
| DMD | ENST00000361471.8 | TSL:1 | c.1019+524_1019+705del | intron | N/A | ENSP00000354464.4 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at