chrX-31177963-TAACGGGACTGCAAAACAAAAAATGAGGTGGTGAAGGAGACACACGCAAACTCAGCCGCAAAAAAATTTACTGAAAGGTCAAAATAAATAAAATCCAGCCAATTAAGTATGAACCATGGAAAGCAATAGCCAAACCAAGGTGTAAAGTGAATTAAAAGAAAAACACACAGTTGTGTGACTGCC-T
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_004006.3(DMD):c.10224-175_10230del(p.Pro3409fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_004006.3 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
DMD | ENST00000357033.9 | c.10224-175_10230del | p.Pro3409fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | Exon 71 of 79 | 1 | NM_004006.3 | ENSP00000354923.3 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Submissions by phenotype
Duchenne muscular dystrophy Pathogenic:1
Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with DMD-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change removes the first 7 nucleotides of exon 71, and affects an acceptor splice site in intron 70 of the DMD gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. Donor and acceptor splice site variants typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in DMD are known to be pathogenic (PMID: 16770791, 25007885). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at