chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T

Variant names:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-T
• NM_000044.6:c.186_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000044.6(AR):​c.186_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln63_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000533 in 937,336 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000053 (0 hom. 0 hem.)
• Consequence: AR NM_000044.6 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.40

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.186_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln63_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.186_239delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln63_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.00000533 AC: 5 AN: 937336 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 295426

Gnomad4 AFR exome AF: 0.0000421

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000278

Gnomad4 OTH exome AF: 0.0000501

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-66765158;