chrX-70027972-GGGACCACCTGGTCCTCCAGGTCCTCCTGGTCCTCAA-G
Variant summary
Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1PM4PP3PP5_Very_Strong
The NM_001399.5(EDA):c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC(p.Pro217_Pro228del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
NM_001399.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- tooth agenesis, selective, X-linked, 1Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- X-linked hypohidrotic ectodermal dysplasiaInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae)
- tooth agenesisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 13 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001399.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| EDA | NM_001399.5 | MANE Select | c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC | p.Pro217_Pro228del | disruptive_inframe_deletion | Exon 4 of 8 | NP_001390.1 | ||
| EDA | NM_001005609.2 | c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC | p.Pro217_Pro228del | disruptive_inframe_deletion | Exon 4 of 8 | NP_001005609.1 | |||
| EDA | NM_001440761.1 | c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC | p.Pro217_Pro228del | disruptive_inframe_deletion | Exon 4 of 8 | NP_001427690.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| EDA | ENST00000374552.9 | TSL:1 MANE Select | c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC | p.Pro217_Pro228del | disruptive_inframe_deletion | Exon 4 of 8 | ENSP00000363680.4 | ||
| EDA | ENST00000374553.6 | TSL:1 | c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC | p.Pro217_Pro228del | disruptive_inframe_deletion | Exon 4 of 8 | ENSP00000363681.2 | ||
| EDA | ENST00000524573.5 | TSL:1 | c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC | p.Pro217_Pro228del | disruptive_inframe_deletion | Exon 4 of 8 | ENSP00000432585.1 |
Frequencies
GnomAD3 genomes Cov.: 21
GnomAD4 genome Cov.: 21
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at