chrX-85244127-G-GGCGGCGGCGGCGGCGGCGGCA

Variant names:

• chrX-85244127-G-GGCGGCGGCGGCGGCGGCGGCA
• rs944048283
• NM_001330574.2:c.-458_-438dupGGCGGCGGCAGCGGCGGCGGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001330574.2(ZNF711):​c.-458_-438dupGGCGGCGGCAGCGGCGGCGGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000259 in 38,647 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 21)
  • Exomes 𝑓: 0.000026 (0 hom. 0 hem.)
• Consequence: ZNF711 NM_001330574.2 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.866
• Publications: 0 publications found

Genes affected

ZNF711 (HGNC:13128): (zinc finger protein 711) This gene encodes a zinc finger protein of unknown function. It bears similarity to a zinc finger protein which acts as a transcriptional activator. This gene lies in a region of the X chromosome which has been associated with cognitive disability. [provided by RefSeq, Jul 2008]

SATL1 (HGNC:27992): (spermidine/spermine N1-acetyl transferase like 1) Predicted to enable N-acetyltransferase activity. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ZNF711	NM_001330574.2	c.-458_-438dupGGCGGCGGCAGCGGCGGCGGC		5_prime_UTR_variant	Exon 1 of 11	ENST00000674551.1	NP_001317503.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ZNF711	ENST00000674551.1	c.-458_-438dupGGCGGCGGCAGCGGCGGCGGC		5_prime_UTR_variant	Exon 1 of 11		NM_001330574.2	ENSP00000502839.1
ZNF711	ENST00000276123.7	c.-453_-433dupGGCGGCGGCAGCGGCGGCGGC		5_prime_UTR_variant	Exon 1 of 10	1		ENSP00000276123.3
ZNF711	ENST00000373165.7	c.-199_-179dupGGCGGCGGCAGCGGCGGCGGC		5_prime_UTR_variant	Exon 1 of 9	1		ENSP00000362260.3
SATL1	ENST00000646235.1	c.-1456_-1436dupTGCCGCCGCCGCCGCCGCCGC		upstream_gene_variant				ENSP00000495329.1

Frequencies

GnomAD3 genomes Cov.: 21

GnomAD4 exome AF: 0.0000259 AC: 1 AN: 38647 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 16735

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 719

American (AMR) AF: 0.00 AC: 0 AN: 905

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 618

East Asian (EAS) AF: 0.00 AC: 0 AN: 2232

South Asian (SAS) AF: 0.000560 AC: 1 AN: 1785

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 2516

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 163

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 27551

Other (OTH) AF: 0.00 AC: 0 AN: 2158

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 21

Alfa AF: 0.00 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.87

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs944048283; hg19: chrX-84499133;