rs104886330

Variant names:

• chrX-108595568-CAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA-C
• rs104886330
• NM_033380.3:c.1485_1516+5delACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAAA

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_033380.3(COL4A5):​c.1485_1516+5delACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAAA​(p.Pro496LeufsTer50) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: COL4A5 NM_033380.3 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 9.00
• Publications: 2 publications found

Genes affected

COL4A5 (HGNC:2207): (collagen type IV alpha 5 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. Mutations in this gene are associated with X-linked Alport syndrome, also known as hereditary nephritis. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]

COL4A5 Gene-Disease associations (from GenCC):

• Alport syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen, G2P
• X-linked Alport syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Genomics England PanelApp, Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_033380.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL4A5	NM_033380.3	MANE Select	c.1485_1516+5delACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAAA	p.Pro496LeufsTer50	frameshift splice_donor splice_region intron	Exon 22 of 53	NP_203699.1
	COL4A5	NM_000495.5		c.1485_1516+5delACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAAA	p.Pro496LeufsTer50	frameshift splice_donor splice_region intron	Exon 22 of 51	NP_000486.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL4A5	ENST00000328300.11	TSL:1 MANE Select	c.1484_1516+4delAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA	p.Gln495_Gly506delinsArg	splice_donor disruptive_inframe_deletion splice_region intron	Exon 22 of 53	ENSP00000331902.7
	COL4A5	ENST00000483338.1	TSL:1	c.308_340+4delAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA	p.Gln103_Gly114delinsArg	splice_donor disruptive_inframe_deletion splice_region intron	Exon 6 of 20	ENSP00000495685.1
	COL4A5	ENST00000361603.7	TSL:2	c.1484_1516+4delAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA	p.Gln495_Gly506delinsArg	splice_donor disruptive_inframe_deletion splice_region intron	Exon 22 of 51	ENSP00000354505.2

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs104886330; hg19: chrX-107838798;