rs104895310

Variant names:

• chr12-109581391-TCAGGGCCCTGCCGAGCCTGGATATCGTAGTGTGGTCGGAGCTGCCCCCCGGGGCGGGCTTGGGCTCCAGCGCCGCCTACTCGGTGTGTCTGGCAGCAGCCCTCCTGACTGTGTGCGAGGAGATCCCAAACCCGCTGAAGGACGGGGATTGCGTCAA-T
• rs104895310
• NM_000431.4:c.373_527+1del

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The ENST00000228510.8(MVK):​c.372-3_524del​(p.Arg124_Asn175delinsSer) variant causes a splice acceptor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. R124R) has been classified as Uncertain significance.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MVK ENST00000228510.8 splice_acceptor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 8.95
• Publications: 0 publications found

Genes affected

MVK (HGNC:7530): (mevalonate kinase) This gene encodes the peroxisomal enzyme mevalonate kinase. Mevalonate is a key intermediate, and mevalonate kinase a key early enzyme, in isoprenoid and sterol synthesis. Mevalonate kinase deficiency caused by mutation of this gene results in mevalonic aciduria, a disease characterized psychomotor retardation, failure to thrive, hepatosplenomegaly, anemia and recurrent febrile crises. Defects in this gene also cause hyperimmunoglobulinaemia D and periodic fever syndrome, a disorder characterized by recurrent episodes of fever associated with lymphadenopathy, arthralgia, gastrointestinal dismay and skin rash. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

MVK Gene-Disease associations (from GenCC):

• porokeratosis 3, disseminated superficial actinic type

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• hyperimmunoglobulinemia D with periodic fever

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• mevalonate kinase deficiency

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• mevalonic aciduria

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• disseminated superficial actinic porokeratosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• porokeratosis of Mibelli

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.13098237 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000228510.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MVK	NM_000431.4	MANE Select	c.373_527+1del	p.Ala125fs	frameshift splice_donor splice_region intron	Exon 5 of 11	NP_000422.1	Q03426
	MVK	NM_001414515.1		c.-210_-56+1del		splice_region	Exon 4 of 10	NP_001401444.1	B7Z1C2
	MVK	NM_001414512.1		c.373_527+1del	p.Ala125fs	frameshift splice_donor splice_region intron	Exon 5 of 12	NP_001401441.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MVK	ENST00000228510.8	TSL:1 MANE Select	c.372-3_524del	p.Arg124_Asn175delinsSer	splice_acceptor disruptive_inframe_deletion splice_region intron	Exon 5 of 11	ENSP00000228510.3	Q03426
	MVK	ENST00000546277.6	TSL:5	c.372-3_524del	p.Arg124_Asn175delinsSer	splice_acceptor disruptive_inframe_deletion splice_region intron	Exon 5 of 11	ENSP00000438153.2	Q03426
	MVK	ENST00000878306.1		c.372-3_524del	p.Arg124_Asn175delinsSer	splice_acceptor disruptive_inframe_deletion splice_region intron	Exon 5 of 11	ENSP00000548365.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs104895310;

hg19: chr12-110019196;