rs1064792890

Positions:

• chr22-50525872-GCCGCTGAGCGCGGGGCCGTC-G

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Moderate PM2 PP5_Moderate

The NM_001953.5(TYMP):​c.1327_1346delGACGGCCCCGCGCTCAGCGG​(p.Asp443fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000208 in 1,439,240 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 34)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: TYMP NM_001953.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.05

Genes affected

TYMP (HGNC:3148): (thymidine phosphorylase) This gene encodes an angiogenic factor which promotes angiogenesis in vivo and stimulates the in vitro growth of a variety of endothelial cells. It has a highly restricted target cell specificity acting only on endothelial cells. Mutations in this gene have been associated with mitochondrial neurogastrointestinal encephalomyopathy. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Apr 2012]

SCO2 (HGNC:10604): (synthesis of cytochrome C oxidase 2) Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6. [provided by RefSeq, Oct 2014]

TYMP (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0842 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 22-50525872-GCCGCTGAGCGCGGGGCCGTC-G is Pathogenic according to our data. Variant chr22-50525872-GCCGCTGAGCGCGGGGCCGTC-G is described in ClinVar as [Pathogenic]. Clinvar id is 223086.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TYMP	NM_001953.5	c.1327_1346delGACGGCCCCGCGCTCAGCGG	p.Asp443fs	frameshift_variant	10/10	ENST00000252029.8	NP_001944.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TYMP	ENST00000252029.8	c.1327_1346delGACGGCCCCGCGCTCAGCGG	p.Asp443fs	frameshift_variant	10/10	1	NM_001953.5	ENSP00000252029.3

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome AF: 0.00000208 AC: 3 AN: 1439240 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 714604

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000181

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 34

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Mitochondrial DNA depletion syndrome 1 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

GeneReviews

Jan 14, 2016

- -

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 16, 2024

This sequence change results in a frameshift in the TYMP gene (p.Asp443Profs*). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 40 amino acid(s) of the TYMP protein and extend the protein by an uncertain number of additional amino acid residues. This variant is not present in population databases (gnomAD no frequency). This frameshift has been observed in individual(s) with clinical features of mitochondrial neurogastrointestinal encephalomyopathy (PMID: 16198108). ClinVar contains an entry for this variant (Variation ID: 223086). This variant disrupts the C-terminus of the TYMP protein. Other variant(s) that disrupt this region (p.Ser471*) have been observed in individuals with TYMP-related conditions (PMID: 9924029, 17437622). This suggests that this may be a clinically significant region of the protein. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064792890; hg19: chr22-50964301;