rs1064792890

Variant names:

• chr22-50525872-GCCGCTGAGCGCGGGGCCGTC-G
• rs1064792890
• NM_001953.5:c.1327_1346delGACGGCCCCGCGCTCAGCGG

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1_Strong PP5_Very_Strong

The NM_001953.5(TYMP):​c.1327_1346delGACGGCCCCGCGCTCAGCGG​(p.Asp443ProfsTer40) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000208 in 1,439,240 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. D443D) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 34)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: TYMP NM_001953.5 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 3.05
• Publications: 1 publications found

Genes affected

TYMP (HGNC:3148): (thymidine phosphorylase) This gene encodes an angiogenic factor which promotes angiogenesis in vivo and stimulates the in vitro growth of a variety of endothelial cells. It has a highly restricted target cell specificity acting only on endothelial cells. Mutations in this gene have been associated with mitochondrial neurogastrointestinal encephalomyopathy. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Apr 2012]

SCO2 (HGNC:10604): (synthesis of cytochrome C oxidase 2) Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6. [provided by RefSeq, Oct 2014]

SCO2 Gene-Disease associations (from GenCC):

• cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, G2P
• Leigh syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• myopia 6

  Inheritance: AD Classification: STRONG, NO_KNOWN Submitted by: G2P, PanelApp Australia
• autosomal recessive axonal charcot-marie-tooth disease due to copper metabolism defect

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 12 pathogenic variants in the truncated region.
• PP5: Variant 22-50525872-GCCGCTGAGCGCGGGGCCGTC-G is Pathogenic according to our data. Variant chr22-50525872-GCCGCTGAGCGCGGGGCCGTC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 223086.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001953.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TYMP	NM_001953.5	MANE Select	c.1327_1346delGACGGCCCCGCGCTCAGCGG	p.Asp443ProfsTer40	frameshift	Exon 10 of 10	NP_001944.1	E5KRG5
	TYMP	NM_001257989.1		c.1342_1361delGACGGCCCCGCGCTCAGCGG	p.Asp448ProfsTer40	frameshift	Exon 10 of 10	NP_001244918.1	P19971-2
	TYMP	NM_001113755.3		c.1327_1346delGACGGCCCCGCGCTCAGCGG	p.Asp443ProfsTer40	frameshift	Exon 10 of 10	NP_001107227.1	E5KRG5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TYMP	ENST00000252029.8	TSL:1 MANE Select	c.1327_1346delGACGGCCCCGCGCTCAGCGG	p.Asp443ProfsTer40	frameshift	Exon 10 of 10	ENSP00000252029.3	P19971-1
	TYMP	ENST00000395681.6	TSL:1	c.1342_1361delGACGGCCCCGCGCTCAGCGG	p.Asp448ProfsTer40	frameshift	Exon 10 of 10	ENSP00000379038.1	P19971-2
	TYMP	ENST00000395678.7	TSL:1	c.1327_1346delGACGGCCCCGCGCTCAGCGG	p.Asp443ProfsTer39	frameshift	Exon 10 of 10	ENSP00000379036.3	P19971-1

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome AF: 0.00000208 AC: 3 AN: 1439240 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 714604

African (AFR) AF: 0.00 AC: 0 AN: 32444

American (AMR) AF: 0.00 AC: 0 AN: 41464

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25678

East Asian (EAS) AF: 0.00 AC: 0 AN: 38592

South Asian (SAS) AF: 0.00 AC: 0 AN: 84586

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 50004

Middle Eastern (MID) AF: 0.000191 AC: 1 AN: 5230

European-Non Finnish (NFE) AF: 0.00000181 AC: 2 AN: 1101974

Other (OTH) AF: 0.00 AC: 0 AN: 59268

GnomAD4 genome Cov.: 34

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Mitochondrial DNA depletion syndrome 1 (2)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792890; hg19: chr22-50964301;