rs1064792914

Variant names:

• chr2-178592434-T-TAAAGAATAAATTCCACCATCTTCATGGGCAGCATTACGAA
• rs1064792914
• NM_001267550.2:c.59531_59570dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001267550.2(TTN):​c.59531_59570dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT​(p.Leu19857PhefsTer3) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TTN NM_001267550.2 frameshift, stop_gained
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2 U:1
• Conservation: PhyloP100: 9.27
• Publications: 0 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-178592434-T-TAAAGAATAAATTCCACCATCTTCATGGGCAGCATTACGAA is Pathogenic according to our data. Variant chr2-178592434-T-TAAAGAATAAATTCCACCATCTTCATGGGCAGCATTACGAA is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 404714.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	NM_001267550.2	MANE Select	c.59531_59570dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT	p.Leu19857PhefsTer3	frameshift stop_gained	Exon 301 of 363	NP_001254479.2	Q8WZ42-12
	TTN	NM_001256850.1		c.54608_54647dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT	p.Leu18216PhefsTer3	frameshift stop_gained	Exon 251 of 313	NP_001243779.1	Q8WZ42-1
	TTN	NM_133378.4		c.51827_51866dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT	p.Leu17289PhefsTer3	frameshift stop_gained	Exon 250 of 312	NP_596869.4	Q8WZ42-11

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	ENST00000589042.5	TSL:5 MANE Select	c.59531_59570dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT	p.Leu19857PhefsTer3	frameshift stop_gained	Exon 301 of 363	ENSP00000467141.1	Q8WZ42-12
	TTN	ENST00000446966.2	TSL:1	c.59375_59414dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT	p.Leu19805PhefsTer3	frameshift stop_gained	Exon 299 of 361	ENSP00000408004.2	A0A1B0GXE3
	TTN	ENST00000436599.2	TSL:1	c.59255_59294dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT	p.Leu19765PhefsTer3	frameshift stop_gained	Exon 299 of 361	ENSP00000405517.2	A0A0C4DG59

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G (1)
1	-	-	Dilated cardiomyopathy 1G (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792914; hg19: chr2-179457161;