rs1064792993
Variant summary
Our verdict is Likely benign. The variant received -3 ACMG points: 0P and 3B. BP3BP6_Moderate
The NM_003924.4(PHOX2B):c.723_743delAGCAGCAGCGGCGGCGGCCGC(p.Ala242_Ala248del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000137 in 145,616 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. A241A) has been classified as Likely benign.
Frequency
Consequence
NM_003924.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- central hypoventilation syndrome, congenital, 1, with or without Hirschsprung diseaseInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, ClinGen
- Haddad syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- neuroblastoma, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
- congenital central hypoventilation syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003924.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PHOX2B | TSL:1 MANE Select | c.723_743delAGCAGCAGCGGCGGCGGCCGC | p.Ala242_Ala248del | disruptive_inframe_deletion | Exon 3 of 3 | ENSP00000226382.2 | Q99453 | ||
| PHOX2B | TSL:3 | n.*4_*24delAGCAGCAGCGGCGGCGGCCGC | downstream_gene | N/A |
Frequencies
GnomAD3 genomes AF: 0.0000137 AC: 2AN: 145616Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.000902 AC: 5AN: 5542 AF XY: 0.00106 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000564 AC: 55AN: 975160Hom.: 0 AF XY: 0.0000648 AC XY: 30AN XY: 463118 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000137 AC: 2AN: 145616Hom.: 0 Cov.: 32 AF XY: 0.0000141 AC XY: 1AN XY: 70832 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.