rs1064792993

Variant names:

• chr4-41746008-CGCGGCCGCCGCCGCTGCTGCT-C
• rs1064792993
• NM_003924.4:c.723_743delAGCAGCAGCGGCGGCGGCCGC

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 0P and 3B. BP3 BP6_Moderate

The NM_003924.4(PHOX2B):​c.723_743delAGCAGCAGCGGCGGCGGCCGC​(p.Ala242_Ala248del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000137 in 145,616 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. A241A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000014 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000056 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PHOX2B NM_003924.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:2
• Conservation: PhyloP100: 2.98
• Publications: 0 publications found

Genes affected

PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

PHOX2B Gene-Disease associations (from GenCC):

• central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
• Haddad syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• neuroblastoma, susceptibility to, 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
• congenital central hypoventilation syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003924.4
• BP6: Variant 4-41746008-CGCGGCCGCCGCCGCTGCTGCT-C is Benign according to our data. Variant chr4-41746008-CGCGGCCGCCGCCGCTGCTGCT-C is described in ClinVar as Likely_benign. ClinVar VariationId is 413918.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003924.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PHOX2B	NM_003924.4	MANE Select	c.723_743delAGCAGCAGCGGCGGCGGCCGC	p.Ala242_Ala248del	disruptive_inframe_deletion	Exon 3 of 3	NP_003915.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PHOX2B	ENST00000226382.4	TSL:1 MANE Select	c.723_743delAGCAGCAGCGGCGGCGGCCGC	p.Ala242_Ala248del	disruptive_inframe_deletion	Exon 3 of 3	ENSP00000226382.2
	PHOX2B	ENST00000510424.2	TSL:3	n.*4_*24delAGCAGCAGCGGCGGCGGCCGC		downstream_gene	N/A

Frequencies

GnomAD3 genomes AF: 0.0000137 AC: 2 AN: 145616 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000396

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000902 AC: 5 AN: 5542 AF XY: 0.00106

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.0278

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000564 AC: 55 AN: 975160 Hom.: 0 AF XY: 0.0000648 AC XY: 30 AN XY: 463118

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000105 AC: 2 AN: 19042

American (AMR) AF: 0.00 AC: 0 AN: 4918

Ashkenazi Jewish (ASJ) AF: 0.000104 AC: 1 AN: 9578

East Asian (EAS) AF: 0.00180 AC: 27 AN: 14992

South Asian (SAS) AF: 0.000431 AC: 8 AN: 18564

European-Finnish (FIN) AF: 0.0000557 AC: 1 AN: 17958

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2376

European-Non Finnish (NFE) AF: 0.0000176 AC: 15 AN: 851722

Other (OTH) AF: 0.0000278 AC: 1 AN: 36010

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000137 AC: 2 AN: 145616 Hom.: 0 Cov.: 32 AF XY: 0.0000141 AC XY: 1 AN XY: 70832

African (AFR) AF: 0.00 AC: 0 AN: 40516

American (AMR) AF: 0.00 AC: 0 AN: 14532

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3372

East Asian (EAS) AF: 0.000396 AC: 2 AN: 5056

South Asian (SAS) AF: 0.00 AC: 0 AN: 4730

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 8824

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 304

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 65364

Other (OTH) AF: 0.00 AC: 0 AN: 2008

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	Haddad syndrome (1)
-	-	1	PHOX2B-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.0
Mutation Taster		=189/11	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792993; hg19: chr4-41748025;