rs1064793736

Variant names:

• chr5-112840567-G-GTGATCTAACAATCGAATCCCCTCCAAA
• rs1064793736
• NM_000038.6:c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_000038.6(APC):​c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA​(p.Asp1659_Asn1667dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: APC NM_000038.6 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 1.51

Genes affected

APC (HGNC:583): (APC regulator of WNT signaling pathway) This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers, where disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jun 2022]

ENSG00000258864 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000038.6.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
APC	NM_000038.6	c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA	p.Asp1659_Asn1667dup	disruptive_inframe_insertion	Exon 16 of 16	ENST00000257430.9	NP_000029.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
APC	ENST00000257430.9	c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA	p.Asp1659_Asn1667dup	disruptive_inframe_insertion	Exon 16 of 16	5	NM_000038.6	ENSP00000257430.4
ENSG00000258864	ENST00000520401.1	n.228+11599_228+11625dupTCTAACAATCGAATCCCCTCCAAATGA		intron_variant	Intron 3 of 7	3		ENSP00000454861.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 65

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial adenomatous polyposis 1 Uncertain:1

Aug 05, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.4977_5003dup, results in the insertion of 9 amino acid(s) of the APC protein (p.Asp1659_Asn1667dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with APC-related conditions. ClinVar contains an entry for this variant (Variation ID: 419228). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not provided Uncertain:1

Jun 10, 2015

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This insertion of 27 nucleotides in APC is denoted c.4977_5003dup27 at the cDNA level and p.D1659_N1667dup at the protein level. The normal sequence, with the bases that are inserted in braces, is GTGA[dup27]GTTA. This in frame insertion occurs in a region which is conserved through mammals and is located within SAMP repeats/axin binding domain (Azzopardi 2008). This variant has not, to our knowledge, been published in the literature as pathogenic or benign. Since in frame duplications may or may not inhibit proper protein functioning, the clinical significance of this finding remains unclear at this time and we consider APC D1659_N1667dup to be a variant of uncertain significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

Jul 02, 2019

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.4977_5003dup27 variant (also known as p.D1659_N1667dup), located in coding exon 15 of the APC gene, results from an in-frame duplication of 27 nucleotides at nucleotide positions 4977 to 5003. This results in the duplication of 9 extra residues (DLTIESPPN) between codons 1659 and 1667. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064793736; hg19: chr5-112176264;