rs1064793736
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000038.6(APC):c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA(p.Asp1659_Asn1667dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). The gene APC is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000038.6 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- classic or attenuated familial adenomatous polyposisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- desmoid tumorInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P
- familial adenomatous polyposis 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- gastric adenocarcinoma and proximal polyposis of the stomachInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- APC-related attenuated familial adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Turcot syndrome with polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Cenani-Lenz syndactyly syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000038.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | MANE Select | c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA | p.Asp1659_Asn1667dup | disruptive_inframe_insertion | Exon 16 of 16 | NP_000029.2 | |||
| APC | c.5061_5087dupTCTAACAATCGAATCCCCTCCAAATGA | p.Asp1687_Asn1695dup | disruptive_inframe_insertion | Exon 16 of 16 | NP_001394375.1 | ||||
| APC | c.5031_5057dupTCTAACAATCGAATCCCCTCCAAATGA | p.Asp1677_Asn1685dup | disruptive_inframe_insertion | Exon 17 of 17 | NP_001341825.1 | R4GMU6 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| APC | TSL:5 MANE Select | c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA | p.Asp1659_Asn1667dup | disruptive_inframe_insertion | Exon 16 of 16 | ENSP00000257430.4 | P25054-1 | ||
| APC | TSL:1 | c.4977_5003dupTCTAACAATCGAATCCCCTCCAAATGA | p.Asp1659_Asn1667dup | disruptive_inframe_insertion | Exon 17 of 17 | ENSP00000427089.2 | P25054-1 | ||
| APC | TSL:1 | n.*4299_*4325dupTCTAACAATCGAATCCCCTCCAAATGA | non_coding_transcript_exon | Exon 17 of 17 | ENSP00000424265.1 | E7EMH9 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 65
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.