rs1131690807

Variant names:

• chr6-26156825-CACCCCCAAGAAGAGCGCCAAGAA-C
• rs1131690807
• NM_005321.3:c.436_458delACCCCCAAGAAGAGCGCCAAGAA

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_005321.3(H1-4):​c.436_458delACCCCCAAGAAGAGCGCCAAGAA​(p.Thr146AspfsTer42) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: H1-4 NM_005321.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2 O:1
• Conservation: PhyloP100: 7.29

Genes affected

H1-4 (HGNC:4718): (H1.4 linker histone, cluster member) Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]

ENSG00000291336 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.339 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 6-26156825-CACCCCCAAGAAGAGCGCCAAGAA-C is Pathogenic according to our data. Variant chr6-26156825-CACCCCCAAGAAGAGCGCCAAGAA-C is described in ClinVar as [Pathogenic]. Clinvar id is 428607.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
H1-4	NM_005321.3	c.436_458delACCCCCAAGAAGAGCGCCAAGAA	p.Thr146AspfsTer42	frameshift_variant	Exon 1 of 1	ENST00000304218.6	NP_005312.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
H1-4	ENST00000304218.6	c.436_458delACCCCCAAGAAGAGCGCCAAGAA	p.Thr146AspfsTer42	frameshift_variant	Exon 1 of 1	6	NM_005321.3	ENSP00000307705.4
ENSG00000291336	ENST00000707189.1	n.999+32655_999+32677delACCCCCAAGAAGAGCGCCAAGAA		intron_variant	Intron 1 of 1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2 Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

Rahman syndrome Pathogenic:1 Other:1

Jun 27, 2017

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

not provided Pathogenic:1

Apr 20, 2023

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed at significant frequency in large population cohorts (gnomAD); Frameshift variant predicted to result in protein truncation, as the last 74 amino acids are replaced with 41 different amino acids; This variant is associated with the following publications: (PMID: 28475857, 32109418, 31910894, 29704315, 33270410) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1131690807; hg19: chr6-26157053;