rs1131690807

Variant names:

• chr6-26156825-CACCCCCAAGAAGAGCGCCAAGAA-C
• rs1131690807
• NM_005321.3:c.436_458delACCCCCAAGAAGAGCGCCAAGAA

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The NM_005321.3(H1-4):​c.436_458delACCCCCAAGAAGAGCGCCAAGAA​(p.Thr146AspfsTer42) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: H1-4 NM_005321.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2 O:1
• Conservation: PhyloP100: 7.29
• Publications: 3 publications found

Genes affected

H1-4 (HGNC:4718): (H1.4 linker histone, cluster member) Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]

H1-4 Gene-Disease associations (from GenCC):

• Rahman syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Illumina, Labcorp Genetics (formerly Invitae), G2P
• syndromic intellectual disability

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen

ENSG00000291336 (HGNC:):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 16 pathogenic variants in the truncated region.
• PP5: Variant 6-26156825-CACCCCCAAGAAGAGCGCCAAGAA-C is Pathogenic according to our data. Variant chr6-26156825-CACCCCCAAGAAGAGCGCCAAGAA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 428607.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005321.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	H1-4	NM_005321.3	MANE Select	c.436_458delACCCCCAAGAAGAGCGCCAAGAA	p.Thr146AspfsTer42	frameshift	Exon 1 of 1	NP_005312.1	P10412

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	H1-4	ENST00000304218.6	TSL:6 MANE Select	c.436_458delACCCCCAAGAAGAGCGCCAAGAA	p.Thr146AspfsTer42	frameshift	Exon 1 of 1	ENSP00000307705.4	P10412
	ENSG00000291336	ENST00000707189.1		n.999+32655_999+32677delACCCCCAAGAAGAGCGCCAAGAA		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)
1	-	-	Rahman syndrome (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.3
Mutation Taster		=7/193	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1131690807; hg19: chr6-26157053;