rs121913313

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3

The NM_020975.6(RET):​c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC​(p.Phe612_Cys620del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. F612F) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

RET
NM_020975.6 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: 8.14

Publications

9 publications found
Variant links:
Genes affected
RET (HGNC:9967): (ret proto-oncogene) This gene encodes a transmembrane receptor and member of the tyrosine protein kinase family of proteins. Binding of ligands such as GDNF (glial cell-line derived neurotrophic factor) and other related proteins to the encoded receptor stimulates receptor dimerization and activation of downstream signaling pathways that play a role in cell differentiation, growth, migration and survival. The encoded receptor is important in development of the nervous system, and the development of organs and tissues derived from the neural crest. This proto-oncogene can undergo oncogenic activation through both cytogenetic rearrangement and activating point mutations. Mutations in this gene are associated with Hirschsprung disease and central hypoventilation syndrome and have been identified in patients with renal agenesis. [provided by RefSeq, Sep 2017]
RET Gene-Disease associations (from GenCC):
  • familial medullary thyroid carcinoma
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
  • multiple endocrine neoplasia type 2A
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P
  • multiple endocrine neoplasia type 2B
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen
  • pheochromocytoma
    Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
  • Hirschsprung disease, susceptibility to, 1
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • Haddad syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Hirschsprung disease
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • renal agenesis, unilateral
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • bilateral renal agenesis
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • renal agenesis
    Inheritance: AR Classification: LIMITED Submitted by: G2P

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

PM1
In a hotspot region, there are 27 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 3 benign, 18 uncertain in NM_020975.6
PM4
Nonframeshift variant in NON repetitive region in NM_020975.6.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
RETNM_020975.6 linkc.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC p.Phe612_Cys620del conservative_inframe_deletion Exon 10 of 20 ENST00000355710.8 NP_066124.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
RETENST00000355710.8 linkc.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC p.Phe612_Cys620del conservative_inframe_deletion Exon 10 of 20 5 NM_020975.6 ENSP00000347942.3

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
8.1
Mutation Taster
=28/172
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs121913313; hg19: chr10-43609073; API