16-1153321-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG

Variant names:

• chr16-1153321-C-CGGGCCGGGGGCGGAGGCGCTGGGGGCCGGGGCCG
• rs1339556967
• NM_021098.3:c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_021098.3(CACNA1H):​c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000186 in 139,544 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.00019 (0 hom., cov: 21)
• Consequence: CACNA1H NM_021098.3 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.64

Genes affected

CACNA1H (HGNC:1395): (calcium voltage-gated channel subunit alpha1 H) This gene encodes a T-type member of the alpha-1 subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. The alpha-1 subunit has 24 transmembrane segments and forms the pore through which ions pass into the cell. There are multiple isoforms of each of the proteins in the complex, either encoded by different genes or the result of alternative splicing of transcripts. Alternate transcriptional splice variants, encoding different isoforms, have been characterized for the gene described here. Studies suggest certain mutations in this gene lead to childhood absence epilepsy (CAE). [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.000186 (26/139544) while in subpopulation EAS AF= 0.000897 (4/4460). AF 95% confidence interval is 0.000306. There are 0 homozygotes in gnomad4. There are 16 alleles in male gnomad4 subpopulation. Median coverage is 21. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 26 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CACNA1H	NM_021098.3	c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR_variant	Exon 1 of 35	ENST00000348261.11	NP_066921.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CACNA1H	ENST00000348261	c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR_variant	Exon 1 of 35	1	NM_021098.3	ENSP00000334198.7
CACNA1H	ENST00000638323	c.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR_variant	Exon 1 of 35	5		ENSP00000492267.1
CACNA1H	ENST00000639478.1	n.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		non_coding_transcript_exon_variant	Exon 1 of 35	5		ENSP00000491945.1
CACNA1H	ENST00000640028.1	n.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		non_coding_transcript_exon_variant	Exon 1 of 35	5		ENSP00000491488.1
CACNA1H	ENST00000639478.1	n.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR_variant	Exon 1 of 35	5		ENSP00000491945.1
CACNA1H	ENST00000640028.1	n.-125_-92dupGGCGGAGGCGCTGGGGGCCGGGGCCGGGGCCGGG		5_prime_UTR_variant	Exon 1 of 35	5		ENSP00000491488.1

Frequencies

GnomAD3 genomes AF: 0.000186 AC: 26 AN: 139540 Hom.: 0 Cov.: 21

Gnomad AFR AF: 0.000467

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000698

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000894

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000129

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000314

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 0

GnomAD4 genome AF: 0.000186 AC: 26 AN: 139544 Hom.: 0 Cov.: 21 AF XY: 0.000236 AC XY: 16 AN XY: 67840

Gnomad4 AFR AF: 0.000467

Gnomad4 AMR AF: 0.0000697

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000897

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000129

Gnomad4 NFE AF: 0.0000314

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1339556967; hg19: chr16-1203321;