rs1356658330
Variant summary
Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2
The NM_001943.5(DSG2):c.-11_11dupGCGAGGGTGCGATGGCGCGGAG(p.Ser4fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000016 in 1,253,122 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001943.5 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 10 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
DSG2 | NM_001943.5 | c.-11_11dupGCGAGGGTGCGATGGCGCGGAG | p.Ser4fs | frameshift_variant | Exon 1 of 15 | ENST00000261590.13 | NP_001934.2 | |
DSG2 | XM_047437315.1 | c.-583_-562dupGCGAGGGTGCGATGGCGCGGAG | 5_prime_UTR_variant | Exon 1 of 16 | XP_047293271.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000659 AC: 1AN: 151786Hom.: 0 Cov.: 32
GnomAD4 exome AF: 9.08e-7 AC: 1AN: 1101336Hom.: 0 Cov.: 30 AF XY: 0.00000191 AC XY: 1AN XY: 523316
GnomAD4 genome AF: 0.00000659 AC: 1AN: 151786Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 74160
ClinVar
Submissions by phenotype
Cardiovascular phenotype Uncertain:1
The c.-11_11dup22 variant results from a duplication of 22 nucleotides at nucleotide positions c.-11 to c.11. This results in the duplication of 11 nucleotides in the 5' untranslated region (UTR) and the first 11 nucleotides, including the methionine residue at the initiation codon (ATG), of coding exon 1 of the DSG2 gene. This nucleotide region is not well conserved in available vertebrate species. Variations that modify the initiation codon (ATG) are expected to result in either loss of translation initiation, N-terminal truncation, or cause a shift in the mRNA reading frame. However, it is unknown whether the duplicated material impacts protein sequence or otherwise affects transcriptional/translational regulatory elements. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at