rs137854905
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000416.3(IFNGR1):c.1204_1230delTGTTCTGAGAGTGATCACTCCAGAAAT(p.Cys402_Asn410del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000821 in 1,461,836 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_000416.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant mendelian susceptibility to mycobacterial diseases due to partial IFNgammaR1 deficiencyInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
- immunodeficiency 27AInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- autosomal recessive Mendelian susceptibility to mycobacterial diseases due to partial IFNgammaR1 deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Mendelian susceptibility to mycobacterial diseases due to complete IFNgammaR1 deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| IFNGR1 | NM_000416.3 | c.1204_1230delTGTTCTGAGAGTGATCACTCCAGAAAT | p.Cys402_Asn410del | conservative_inframe_deletion | Exon 7 of 7 | ENST00000367739.9 | NP_000407.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.00000398 AC: 1AN: 251006 AF XY: 0.00 show subpopulations
GnomAD4 exome AF: 0.00000821 AC: 12AN: 1461836Hom.: 0 AF XY: 0.0000110 AC XY: 8AN XY: 727218 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at