rs137854905

Variant names:

• chr6-137198270-CATTTCTGGAGTGATCACTCTCAGAACA-C
• rs137854905
• NM_000416.3:c.1204_1230delTGTTCTGAGAGTGATCACTCCAGAAAT

Your query was ambiguous. Multiple possible variants found:

• chr6-137198270-CATTTCTGGAGTGATCACTCTCAGAACA-C
• chr6-137198270-CATTTCTGGAGTGATCACTCTCAGAACA-CATTTCTGGAGTGATCACTCTCAGAACAATTTCTGGAGTGATCACTCTCAGAACA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000416.3(IFNGR1):​c.1204_1230delTGTTCTGAGAGTGATCACTCCAGAAAT​(p.Cys402_Asn410del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000821 in 1,461,836 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000082 (0 hom.)
• Consequence: IFNGR1 NM_000416.3 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.335
• Publications: 4 publications found

Genes affected

IFNGR1 (HGNC:5439): (interferon gamma receptor 1) This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]

IFNGR1 Gene-Disease associations (from GenCC):

• autosomal dominant mendelian susceptibility to mycobacterial diseases due to partial IFNgammaR1 deficiency

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)
• immunodeficiency 27A

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• autosomal recessive Mendelian susceptibility to mycobacterial diseases due to partial IFNgammaR1 deficiency

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Mendelian susceptibility to mycobacterial diseases due to complete IFNgammaR1 deficiency

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000416.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000416.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IFNGR1	NM_000416.3	MANE Select	c.1204_1230delTGTTCTGAGAGTGATCACTCCAGAAAT	p.Cys402_Asn410del	conservative_inframe_deletion	Exon 7 of 7	NP_000407.1	A0A0S2Z3Y2
	IFNGR1	NM_001363526.1		c.1174_1200delTGTTCTGAGAGTGATCACTCCAGAAAT	p.Cys392_Asn400del	conservative_inframe_deletion	Exon 8 of 8	NP_001350455.1	A0A2R8Y4U4
	IFNGR1	NM_001363527.1		c.1081_1107delTGTTCTGAGAGTGATCACTCCAGAAAT	p.Cys361_Asn369del	conservative_inframe_deletion	Exon 7 of 7	NP_001350456.1	A0A2R8YFL3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IFNGR1	ENST00000367739.9	TSL:1 MANE Select	c.1204_1230delTGTTCTGAGAGTGATCACTCCAGAAAT	p.Cys402_Asn410del	conservative_inframe_deletion	Exon 7 of 7	ENSP00000356713.5	P15260-1
	IFNGR1	ENST00000957752.1		c.1198_1224delTGTTCTGAGAGTGATCACTCCAGAAAT	p.Cys400_Asn408del	conservative_inframe_deletion	Exon 7 of 7	ENSP00000627811.1
	IFNGR1	ENST00000414770.6	TSL:3	c.1174_1200delTGTTCTGAGAGTGATCACTCCAGAAAT	p.Cys392_Asn400del	conservative_inframe_deletion	Exon 8 of 8	ENSP00000394230.2	A0A2R8Y4U4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251006 AF XY: 0.00

Gnomad AFR exome AF: 0.0000620

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000821 AC: 12 AN: 1461836 Hom.: 0 AF XY: 0.0000110 AC XY: 8 AN XY: 727218

African (AFR) AF: 0.0000299 AC: 1 AN: 33468

American (AMR) AF: 0.0000224 AC: 1 AN: 44704

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86252

European-Finnish (FIN) AF: 0.0000374 AC: 2 AN: 53410

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000629 AC: 7 AN: 1112006

Other (OTH) AF: 0.00 AC: 0 AN: 60392

GnomAD4 genome Cov.: 32

Alfa AF: 0.0000507 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.34

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs137854905; hg19: chr6-137519407;