rs1414498654
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001372.4(DNAH9):c.14_34delAGGAGCGGGCCGCGCTCGCGG(p.Glu5_Ala11del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000155 in 1,357,400 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001372.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
DNAH9 | ENST00000262442.9 | c.14_34delAGGAGCGGGCCGCGCTCGCGG | p.Glu5_Ala11del | disruptive_inframe_deletion | Exon 1 of 69 | 1 | NM_001372.4 | ENSP00000262442.3 | ||
DNAH9 | ENST00000579406.1 | n.41_61delAGGAGCGGGCCGCGCTCGCGG | non_coding_transcript_exon_variant | Exon 1 of 8 | 1 | |||||
DNAH9 | ENST00000454412.6 | c.14_34delAGGAGCGGGCCGCGCTCGCGG | p.Glu5_Ala11del | disruptive_inframe_deletion | Exon 1 of 68 | 5 | ENSP00000414874.2 | |||
DNAH9 | ENST00000579828.5 | c.14_34delAGGAGCGGGCCGCGCTCGCGG | p.Glu5_Ala11del | disruptive_inframe_deletion | Exon 1 of 4 | 2 | ENSP00000463782.1 |
Frequencies
GnomAD3 genomes AF: 0.0000332 AC: 5AN: 150802Hom.: 0 Cov.: 31
GnomAD4 exome AF: 0.0000133 AC: 16AN: 1206480Hom.: 0 AF XY: 0.0000171 AC XY: 10AN XY: 586434
GnomAD4 genome AF: 0.0000331 AC: 5AN: 150920Hom.: 0 Cov.: 31 AF XY: 0.0000271 AC XY: 2AN XY: 73762
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant, c.14_34del, results in the deletion of 7 amino acid(s) of the DNAH9 protein (p.Glu5_Ala11del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with DNAH9-related conditions. ClinVar contains an entry for this variant (Variation ID: 1525609). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at