rs1445771901

Variant names:

• chr4-5711351-TGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCC-T
• rs1445771901
• NM_153717.3:c.-16_20delAGCCTGAGCGCCCCGGATGGCCCGCGGCGGGGCGGC

Variant summary

Our verdict is Pathogenic. Variant got 20 ACMG points: 20P and 0B. PVS1 PS1_Moderate PM2 PP5_Very_Strong

The NM_153717.3(EVC):​c.-16_20delAGCCTGAGCGCCCCGGATGGCCCGCGGCGGGGCGGC​(p.Met1_Ala7del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000893 in 1,007,524 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000070 (0 hom.)
• Consequence: EVC NM_153717.3 start_lost, conservative_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 2.03

Genes affected

EVC (HGNC:3497): (EvC ciliary complex subunit 1) This gene encodes a protein containing a leucine zipper and a transmembrane domain. This gene has been implicated in both Ellis-van Creveld syndrome (EvC) and Weyers acrodental dysostosis. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 20 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PS1: Another start lost variant in NM_153717.3 (EVC) was described as [Pathogenic] in Lovd
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-5711351-TGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCC-T is Pathogenic according to our data. Variant chr4-5711351-TGCGGCGGGGCGGCAGCCTGAGCGCCCCGGATGGCCC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1521488.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EVC	NM_153717.3	c.-16_20delAGCCTGAGCGCCCCGGATGGCCCGCGGCGGGGCGGC	p.Met1_Ala7del	start_lost, conservative_inframe_deletion	Exon 1 of 21	ENST00000264956.11	NP_714928.1
EVC	NM_153717.3	c.-16_20delAGCCTGAGCGCCCCGGATGGCCCGCGGCGGGGCGGC		5_prime_UTR_variant	Exon 1 of 21	ENST00000264956.11	NP_714928.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EVC	ENST00000264956.11	c.-16_20delAGCCTGAGCGCCCCGGATGGCCCGCGGCGGGGCGGC	p.Met1_Ala7del	start_lost, conservative_inframe_deletion	Exon 1 of 21	1	NM_153717.3	ENSP00000264956.6
EVC	ENST00000509451.1	c.-16_20delAGCCTGAGCGCCCCGGATGGCCCGCGGCGGGGCGGC	p.Met1_Ala7del	start_lost, conservative_inframe_deletion	Exon 1 of 12	1		ENSP00000426774.1
EVC	ENST00000264956	c.-16_20delAGCCTGAGCGCCCCGGATGGCCCGCGGCGGGGCGGC		5_prime_UTR_variant	Exon 1 of 21	1	NM_153717.3	ENSP00000264956.6
EVC	ENST00000509451	c.-16_20delAGCCTGAGCGCCCCGGATGGCCCGCGGCGGGGCGGC		5_prime_UTR_variant	Exon 1 of 12	1		ENSP00000426774.1

Frequencies

GnomAD3 genomes AF: 0.0000199 AC: 3 AN: 150662 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000727

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000700 AC: 6 AN: 856862 Hom.: 0 AF XY: 0.00000753 AC XY: 3 AN XY: 398372

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000174

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000257

Gnomad4 OTH exome AF: 0.0000349

GnomAD4 genome AF: 0.0000199 AC: 3 AN: 150662 Hom.: 0 Cov.: 32 AF XY: 0.0000136 AC XY: 1 AN XY: 73582

Gnomad4 AFR AF: 0.0000727

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Ellis-van Creveld syndrome;C0457013:Curry-Hall syndrome Pathogenic:2

Jun 04, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Sep 13, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the EVC mRNA. The next in-frame methionine is located at codon 92. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. Disruption of the initiator codon has been observed in individuals with Ellis-van Creveld syndrome (PMID: 19810119, 28854412). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 1521488). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1445771901; hg19: chr4-5713078;