rs1553127831

Variant names:

• chr1-11243184-A-ACTCAGACCTCACAGCCACAGAAAGTAGCCCCAGGGCTTGGAAGGCCGCTGTACGTTCCTTCTCCTT
• rs1553127831
• NM_004958.4:c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_004958.4(MTOR):​c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG​(p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). The gene MTOR is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MTOR NM_004958.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.524
• Publications: 0 publications found

Genes affected

MTOR (HGNC:3942): (mechanistic target of rapamycin kinase) The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This kinase is a component of two distinct complexes, mTORC1, which controls protein synthesis, cell growth and proliferation, and mTORC2, which is a regulator of the actin cytoskeleton, and promotes cell survival and cell cycle progression. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. Inhibitors of mTOR are used in organ transplants as immunosuppressants, and are being evaluated for their therapeutic potential in SARS-CoV-2 infections. Mutations in this gene are associated with Smith-Kingsmore syndrome and somatic focal cortical dysplasia type II. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Aug 2020]

MTOR Gene-Disease associations (from GenCC):

• macrocephaly-intellectual disability-neurodevelopmental disorder-small thorax syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Illumina
• overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen

ACMG classification

Specifications for MTOR are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004958.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004958.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MTOR	NM_004958.4	MANE Select	c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG	p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu	conservative_inframe_insertion	Exon 9 of 58	NP_004949.1	P42345
	MTOR	NM_001386500.1		c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG	p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu	conservative_inframe_insertion	Exon 9 of 58	NP_001373429.1	P42345
	MTOR	NM_001386501.1		c.28_93dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG	p.Glu31_Phe32insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu	conservative_inframe_insertion	Exon 8 of 57	NP_001373430.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MTOR	ENST00000361445.9	TSL:1 MANE Select	c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG	p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu	conservative_inframe_insertion	Exon 9 of 58	ENSP00000354558.4	P42345
	MTOR	ENST00000934315.1		c.1330_1395dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG	p.Glu465_Phe466insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu	conservative_inframe_insertion	Exon 9 of 58	ENSP00000604374.1
	MTOR	ENST00000934312.1		c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG	p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu	conservative_inframe_insertion	Exon 9 of 58	ENSP00000604371.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.52

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553127831; hg19: chr1-11303241;