rs1553127831
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_004958.4(MTOR):c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG(p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). The gene MTOR is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_004958.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- macrocephaly-intellectual disability-neurodevelopmental disorder-small thorax syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Illumina, Labcorp Genetics (formerly Invitae)
- overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genesInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004958.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MTOR | MANE Select | c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG | p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu | conservative_inframe_insertion | Exon 9 of 58 | NP_004949.1 | P42345 | ||
| MTOR | c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG | p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu | conservative_inframe_insertion | Exon 9 of 58 | NP_001373429.1 | P42345 | |||
| MTOR | c.28_93dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG | p.Glu31_Phe32insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu | conservative_inframe_insertion | Exon 8 of 57 | NP_001373430.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MTOR | TSL:1 MANE Select | c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG | p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu | conservative_inframe_insertion | Exon 9 of 58 | ENSP00000354558.4 | P42345 | ||
| MTOR | c.1330_1395dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG | p.Glu465_Phe466insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu | conservative_inframe_insertion | Exon 9 of 58 | ENSP00000604374.1 | ||||
| MTOR | c.1276_1341dupAAGGAGAAGGAACGTACAGCGGCCTTCCAAGCCCTGGGGCTACTTTCTGTGGCTGTGAGGTCTGAG | p.Glu447_Phe448insLysGluLysGluArgThrAlaAlaPheGlnAlaLeuGlyLeuLeuSerValAlaValArgSerGlu | conservative_inframe_insertion | Exon 9 of 58 | ENSP00000604371.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.