rs1553255366

Positions:

• chr1-229431916-CGGGGAGCGTGAGCAGAAGCTC-GGGGGGAGCGTGAGCAGAAGCT

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2 BP6_Moderate

The NM_001100.4(ACTA1):​c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Benign (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: ACTA1 NM_001100.4 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.611

Genes affected

ACTA1 (HGNC:129): (actin alpha 1, skeletal muscle) The product encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. Mutations in this gene cause a variety of myopathies, including nemaline myopathy, congenital myopathy with excess of thin myofilaments, congenital myopathy with cores, and congenital myopathy with fiber-type disproportion, diseases that lead to muscle fiber defects with manifestations such as hypotonia. [provided by RefSeq, Sep 2019]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 1-229431916-CGGGGAGCGTGAGCAGAAGCTC-GGGGGGAGCGTGAGCAGAAGCT is Benign according to our data. Variant chr1-229431916-CGGGGAGCGTGAGCAGAAGCTC-GGGGGGAGCGTGAGCAGAAGCT is described in ClinVar as [Benign]. Clinvar id is 517171.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ACTA1	NM_001100.4	c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC		intron_variant		ENST00000366684.7	NP_001091.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ACTA1	ENST00000366684.7	c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC		intron_variant		1	NM_001100.4	ENSP00000355645.3
ACTA1	ENST00000366683.4	c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC		intron_variant		5		ENSP00000355644.4
ACTA1	ENST00000684723.1	c.674-35_674-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC		intron_variant				ENSP00000508084.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Benign, criteria provided, single submitter

clinical testing

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Dec 13, 2016

c.809-35_809-14delins22 in intron 5 of ACTA1: This variant is not expected to ha ve clinical significance because it has been identified (as separate changes) in 15 - 21% of chromosomes from multiple diverse populations by the Genome Aggrega tion Database (gnomAD, http://gnomad.broadinstitute.org/; dbSNP: rs59228224; rs2 01427429; rs398123565) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553255366; hg19: chr1-229567663;