rs1553266460

chr1-156138482-TCCCAGGGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGAGTACAACCTGCGCTCGCGCACCGTGCTGTGCGGGACCTGCGGGCAGCCTGCCGACAAGGCATCTGCCAGCGGCTCAGGAGCCCAGGTGGGCGGACCCATCTCCTCTGGCTCTTCTGCCTCCAGTGTCACGGTCACTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGCTTCGGGGACAATCTGGTCACCCGCTCCTACCTCCTGGGCAACTCCAGCCCCCGAA-T

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_170707.4(LMNA):c.1700_1968+1del variant causes a splice acceptor, coding sequence, intron change. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: LMNA NM_170707.4 splice_acceptor, coding_sequence, intron
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 6.25

Genes affected

LMNA (HGNC:6636): (lamin A/C) The protein encoded by this gene is part of the nuclear lamina, a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing variant, NOT destroyed by nmd, known LOF gene, truncates exone, which is 0.13483709 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
LMNA	NM_170707.4	c.1700_1968+1del		splice_acceptor_variant, coding_sequence_variant, intron_variant	11/12	ENST00000368300.9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
LMNA	ENST00000368300.9	c.1700_1968+1del		splice_acceptor_variant, coding_sequence_variant, intron_variant	11/12	1	NM_170707.4	P1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Hutchinson-Gilford syndrome Other:1

not provided, no classification provided

literature only

GeneReviews

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553266460; hg19: chr1-156108273;