rs1553318205

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1PM2PP5

The NM_014946.4(SPAST):​c.1322-30_1322-2delATTAAAGTCTTATACTTGTATTTCCTCTA variant causes a splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

Frequency

Genomes: not found (cov: 32)

Consequence

SPAST
NM_014946.4 splice_acceptor, splice_region, intron

Scores

Not classified

Clinical Significance

Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1U:1

Conservation

PhyloP100: 2.13
Variant links:
Genes affected
SPAST (HGNC:11233): (spastin) This gene encodes a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. The use of alternative translational initiation sites in this gene results in a single transcript variant that can produce isoforms that differ in the length of their N-terminus and which thereby differ in the efficiency of their export from the nucleus to the cytoplasm. In addition, alternative splicing results in multiple transcript variants that encode isoforms that differ in other protein regions as well. One isoform of this gene has been shown to be a microtubule-severing enzyme that regulates microtubule abundance, mobility, and plus-end distribution. Mutations in this gene cause the most frequent form of autosomal dominant spastic paraplegia 4. [provided by RefSeq, May 2018]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 11 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-32136844-TTAATTAAAGTCTTATACTTGTATTTCCTC-T is Pathogenic according to our data. Variant chr2-32136844-TTAATTAAAGTCTTATACTTGTATTTCCTC-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 448446.We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=1, Pathogenic=1}.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
SPASTNM_014946.4 linkc.1322-30_1322-2delATTAAAGTCTTATACTTGTATTTCCTCTA splice_acceptor_variant, splice_region_variant, intron_variant ENST00000315285.9 NP_055761.2 Q9UBP0-1E5KRP5

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
SPASTENST00000315285.9 linkc.1322-32_1322-4delTAATTAAAGTCTTATACTTGTATTTCCTC splice_region_variant, intron_variant 1 NM_014946.4 ENSP00000320885.3 Q9UBP0-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Conflicting classifications of pathogenicity
Submissions summary: Pathogenic:1Uncertain:1
Revision: criteria provided, conflicting classifications
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingAthena DiagnosticsOct 24, 2024This variant is expected to severely impact normal RNA splicing, and consequently, protein structure and/or function. This variant has not been reported in large, multi-ethnic general populations. (http://gnomad.broadinstitute.org) This variant has been identified in at least one individual with clinical features associated with this gene. -
Hereditary spastic paraplegia 4 Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpDec 12, 2022In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 448446). This variant is also known as c.1322-31del29bp (p.I440fs). This variant has been observed in individuals with clinical features of SPAST-related conditions (PMID: 20718791; Invitae). This variant is not present in population databases (gnomAD no frequency). This sequence change falls in intron 10 of the SPAST gene. It does not directly change the encoded amino acid sequence of the SPAST protein. It affects a nucleotide within the consensus splice site. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553318205; hg19: chr2-32361913; API